Loading...

Table of Content

    24 June 1999, Volume 20 Issue 6
    Articles
    Synthesis and Crystal Structure of a Tetranuclear Silver Cluster Complex with Selenophenolate Ligand [Me4N]2[Ag4(SePh)6]·CH3OH
    JIN Xiang-Lin, TANG Ka-Luo, LONG Yao-Ling, LIANG Yu, TANG You-Qi
    1999, 20(6):  831-834. 
    Asbtract ( )   PDF (1594KB) ( )  
    Related Articles | Metrics
    The title complex was prepared from the reaction of PhSeH, Et3N, AgNO3and Me4NCL IN CH3CN/MeO Hunder a nitrogen atmosphere. The colorless, airsensitive crystal belongs to the monoclinic system with space group P21/c, a=1.7094(3) nm, b=15626(3) nm, c=2.1237(4) nm,β =110.83(3), V=5.3017(17)nm3, Dc=1.940 g/cm3, Z=4. The final Ris 0.0809 for 6938 reflection. The structure of the title complex is built up by Ag4Se6adamatanetype cluster anion and bulky cation. The structure of the title cluster anion [Ag4(SePh)6]2-can be considered as a tetrahedron of silver atoms inscribed in a distorted octahedron of selenium atoms. The silver atoms are in a distorted trigonal planar coordination by three μ2-selenium atoms.
    Photochromism of the Ternary System of Europium N,N-Bis-(N-methylenesuccinimido)glycine-1,10-phenanthroline
    WANG Li-Ya, ZHENG Xiang-Jun, WANG Hong-Zhi, JIN Lin-Pei, GUO Jian-Quan, WU Yong-Ren, YIN Cheng-Lie
    1999, 20(6):  835-838. 
    Asbtract ( )   PDF (195KB) ( )  
    Related Articles | Metrics
    In the present paper, N,N-bis-(N-methylenesuccinimido) glycine(MSIG) was synthesized and characterized by elemental analysis, IR, 1HNMR and MS. It is demonstrated by experiment that the europium complex of MSIG with 1,10-phenanthroline has reversible photochromism which occurs rarely in lanthanide complexes. Photochromic behavior of the europium complex was investigated in H2O and H2O-C2H5OH solvents. The irradiation of the europium complex solution led to a new absorption band with the maximum wavelength at ~616 nm while the color of the solution turned from yellow to green, and when the photolysate was kept in dark, the absorption spectrum turned to its initial figure. The results show that the spectral signal at ~616 nm appeared on irradiation and in general disappeared within 1h at ambient temperature. The yellow color of the europium complex solution turns green rapidly when irradiated as pHof the solution increases in a range of 46. On heating the color changes from green to yellow readily. The ab mismsorption spectra, the fluorescence spectra and the conductance measurement show that the europium ion is bonded to the carboxyl group of MSIG and the nitrogen atoms from 1,10-phenanthroline, and probably to water and hydroxyl group in the colored europium species.
    Synthesis and Crystal Structure of Europium Complex[Eu2C40H46N6O8·2(NO3)]
    KONG Fan-Rong, ZHANG Min
    1999, 20(6):  839-842. 
    Asbtract ( )   PDF (1402KB) ( )  
    Related Articles | Metrics
    The title complex[Eu2C40H46N6O8·2(NO3)] was prepared and characterized by X-ray diffraction. The Ligand is dischiff base from ovanillin and diethylenetriamine. The complex crystallizes in monoclinic system, space P21/c, a=1.6546(3)nm, b=1.6519(3) nm, c=1.5807(3) nm, β =91.81(3), V=4.318(2)nm3, Dx=1.795Mg·m-3, z=4, =2.9557mm-1, F(000)=2320, the final R=0.058, Rw=0.076. In the complex the coordination number of Eu(Ⅲ) is 8 with a geometry of bicapped trigonal prism. The coordination atoms are oxygen atoms and nitrogen atoms.
    The Preparation and Characterization of Nanosized Pd(OH)2and Its Application in the Catalytic Hydrogenolysis of HBIW
    ZHENG Fu-Ping, OU Yu-Xiang, CHEN Jiang-Tao, ZHOU Zhi-Ming, CHEN Bo-Ren, YE Lin, ZHAO Dao-Hui
    1999, 20(6):  843-845. 
    Asbtract ( )   PDF (748KB) ( )  
    Related Articles | Metrics
    Nanoscale Pd(OH)2was prepared by azeotropic distillation process for the first time, and its structure was characterized by high resolution TEM, DLS and UV-V is absorption spectrum. The results show that the particle size of the prepared Pd(OH)2is of 37.3nm and the particles are facecentred cubic polycrystalline. The prepared Pd(OH)2nanosized particles show a higher catalytic activity than 20%Pd(OH)2/C in the catalytic hydrogenolysis of 2,4,6,8,10,12-hexabenzyl-2,4,6,8,10,12-hexaazaisowurtztane(HBIW).
    Synthesis and Characterization for Complex η2-C60[RhCl(CO)(PPh3)2]
    WU Zhen-Yi, CHENG Da-Dian, YANG Shi-Yao, LIN Yong-Sheng, ZHAN Meng-Xiong, ZHENG Lan-Sun
    1999, 20(6):  846-848. 
    Asbtract ( )   PDF (618KB) ( )  
    Related Articles | Metrics
    The fullerene complex,η2-C60[RhCl(CO)(PPh3)2], has been prepared by the reaction of C60with RhCl(CO)(PPh3)2in benzene at room temperature. The new complex was characterized by elemental analysis, IR, XPS and electronic spectra. The result show that the complex of 2 form can be formed by C60bonding to RhCl(CO)(PPh3)2in the σ-π way. In addition, the complex structure has been supposed.
    Molecular Recognition of Amines by Phenylalanine Bridged Chiral Zinc Bisporphyrin Receptor
    LIU Hai-Yang, HU Xi-Ming, YING Xiao, LIU Yi, HUANG Jian, HUANG Jin-Wang, JI Liang-Nian, TIAN Xuan, YANG Li, ZHU Qi-Xiu
    1999, 20(6):  849-851. 
    Asbtract ( )   PDF (491KB) ( )  
    Related Articles | Metrics
    Interactions between amines and chiral zinc bisporphyrin linked with flexible alkyl chain containing phenylalanine (±)-1 were investigated by circular dichroism(CD) and UV-V is spectroscopic titration method. CD and UV-Vis spectra of phenylalanine bridged chiral zinc bisporphyrin changes quite differently with the addition of propylamine and ethylenediamine in chloroform at room temperature. Our results indicate that phenylalanine bridged chiral zinc bisporphyrin is a potential CD probe of the functional group recognition for monoamine and diamine molecules as well as CD probe of the size specific recognition for,diamines.
    Studies of Non-covalent Protein Complexes by MALDI Methods
    SHE Yi-Min, JI Yi-Ping
    1999, 20(6):  852-855. 
    Asbtract ( )   PDF (243KB) ( )  
    Related Articles | Metrics
    Several specific non-covalent protein complexes were successfully observed by matrix assisted desorption ionization mass spectrometry(MALDI MS). The methods described in this paper include the matrixes use of sinapinic acid(SA) and 6-aza-2-thiothymine(ATT) in neutral pHsolution, as well as the improvement of two-layer sample preparation method to achieve a high sensitivity detection of stable non-covalent complexes. Myoglobin-heme complex was found simultaneously with the sinapinic acid matrix in the various pHsolution(pH=2 or pH=5). The RNase Scomplex showed a striking intensity at the first shot, which was decreased with more laser shots. Most importantly, the observation of specific noncovalent complex in the brome mosaic virus(BMV) coat proteins would open up a new possibility to investigate the assembly and disassembly of viral capsids.
    Separation of Phenothiazines Using Aqueous and Nonaqueous Capillary Electrophoresis
    LU Xiao-Ning, WANG Rong-Ying, WU Ming-Jia
    1999, 20(6):  856-860. 
    Asbtract ( )   PDF (1339KB) ( )  
    Related Articles | Metrics
    Separations of phenothiazines, promethazine(PZ), dioxypromethazine(OZ), chlorpromazine(CZ), trifluoperazine(TfZ) and thioridazine(TZ) by capillary electrophoresis in water and FA media were carried out and compared. Thus different selectivity and resolution were observed as media varying from water to FA. Migration order was PZ, OZ, CZ and TZ in water but (TZ+PZ), CZ and OZ in FA, when the same buffer, 25 mmol/L Tris and 25 mmol/Lcitric acid, was used. It also has been observed that pH has great effect on selectivity both in water and FA and a possible explanation was given. Separation efficiency was higher in FAmedia than in water because of the permission of high voltage applied. For all separations in FA 30kV was applied, and when 25mmol/L Tris was used as buffer, current was only 20 A and complete separation of TZ, CZ, PZ and OZ was achieved with effencicy higher than 3.5×105theoretical plates for all analytes. The high performance of capillary electrophoresis in FA suggests that FAis an exc.
    Modeling with Cyclic Subspace Regression for Quantitative Structureactivity Relationships of 1-Substituted 7-[3-[(ethylamino)methy]-1-pyrrolidinyl]
    SUN Wei-Guo, CHEN De-Zhao, CHEN Ya-Qiu, YE Ning, HU Shang-Xu
    1999, 20(6):  861-865. 
    Asbtract ( )   PDF (234KB) ( )  
    Related Articles | Metrics
    The cyclic subspace regression(CSR) was analyzed from the viewpoint of linear functiona LIN the paper. By extracting components from independent variable and dependent variable parameter matrixes, CSR circularly configured and expanded Krylov subspace, and ultimately a real function was obtained which was mapped into independent variable real space according to the least square criterion. The whole solving process subsumes LSR, PCR, PLS and other medial regression algorithms. The optimal modeLIs selected from which has the minimum predictive error and the maximum stability. By using modeling with CSR for quantitative structure-activity relationships of N1 quinolone antibacterial, preferable results were obtained.
    Studies on Spectroelectrochemistry of Adriamycin
    FENG Min, HE Pin-Gang, YANG Yu-Lin, FANG Yu-Zhi
    1999, 20(6):  866-871. 
    Asbtract ( )   PDF (266KB) ( )  
    Related Articles | Metrics
    The electrochemical behavior of Adriamycin(ADM) at graphite electrode has been investigated by spectroelectrochemistry and cyclic voltammetry. The electrode reaction mechanism of ADM at different potentials has been described. In the positive potential range, a oneelectron transfer occurs accompanied with a consequent chemical reaction, corresponding to oxidation of hydroquinone functionality to the quinone. At negative potential, Adriamycin involves in a reversible-one electron reduction producing semiquinone species, the latter undergoes a subsequent irreversible chemical reaction with elimination of the glycoside, giving the 7-deoxyadriamycinone, which could be reversibly reduced at more negative potentials. The ECE mechanism has been proposed to explain the electrode reduction process.
    Interaction Between Flourescence Chemosensors with Pyrene and Calf Thymus DNA
    LI Hua-Ping, WANG Peng-Fei, WU Shi-Kang
    1999, 20(6):  872-878. 
    Asbtract ( )   PDF (682KB) ( )  
    Related Articles | Metrics
    The quenching spectra of fluorescence chemosensors with pyrene by calf thymus DNA were studied in this work. The fluorescence quenching of both monomer and excimer of pyrene by ctDNA were investigated. The quenching constants of fluorescence chemosensors by ctDNA from SternVolmer equation were compared as following: for monomer, compound 2>compound 1>pyrenyl burytic acid>compound 3; for excimer, compound 2compound 3 . The stability constants of the interaction between fluorescence chemosensors and ctDNA were calculated according to equation (2). Of which the interaction between fluorescence chemosensors and ctDNA has been proposed according to their molecular structure, configuration, atom-atom distances and molecular size. The results obtained were discussed preliminarily.
    Mass Amplification of Biotin-avidin System in Piezoelectric Immunosensor
    PEI Ren-Jun, HU Ji-Ming, LIU Li-Jia, HU Yi, ZENG Yun-E
    1999, 20(6):  879-880. 
    Asbtract ( )   PDF (291KB) ( )  
    Related Articles | Metrics
    Piezoelectric immunosensor has a vast future of applications in biochemistry and clinical medicine. Mass amplification immune assay could improve the detection sensitivity remarkably and would enlarged the application fields remarkably. In this paper, we first developed amplification immune assay of piezoelectric immunosensor using biotinavidin system. The mass adsorbed on the crystal surface was amplified and the detection sensitivity of the sensor improved remarkably so that the detection range was enlarged and the detection low limit of linear range was declined.
    PAPH2O2HRP Voltammetric Enzymelinked Immunoassay for Trace Thyroxine in Human Serum
    ZHANG Shu-Sheng, JIAO Kui, CHEN Hong-Yuan
    1999, 20(6):  881-883. 
    Asbtract ( )   PDF (757KB) ( )  
    Related Articles | Metrics
    A voltammetric enzymelinked immunoassay based on new system of p-aminophenol(PAP)H2O2-horseradish peroxidase(HRP) has firstly been developed and used for the detection of HRP and thyroxine(T4). HRP or labelled HRP catalyzes the oxidation reaction of PAP with H2O2, the product of which produces a sensitive voltammetric peak at potential of -0.45 V(vs. SCE) in BrittonRobinson(B-R) buffer solution. By using this voltammetric peak, the detection limit to thyroxine(T4)is 10 ng/mLand the linear range 1.0-320 ng/mL. The detection limit to T4with this method is lower than that with the enzymelinked immunosorbent spectrophotometric assay(ELISA). Some human serum samples have been analyzed and satisfactory results have been obtained.
    Enantioselective Permeation of Amino Acids Through β-Cyclodextrin Polymer Membranes
    LONG Yuan-De, HUANG Tian-Bao
    1999, 20(6):  884-886. 
    Asbtract ( )   PDF (353KB) ( )  
    Related Articles | Metrics
    The β-cyclodextrin polymer membranes based on poly(vinyl alcohol) for enantioselective permeation of amino acids were described. The cyclodextrin membrane modified with acetic anhydride had higher permeation enantioselectivity of DL-amino acids than the unmodified membrane. The enhanced abilities were explained as a result of the additional steric hindrance effect besides inclusion. The maximum of enantiomeric excess for DLtryptophan was 25.4% with the permeation rate of D-tryptophan being up to 1.48×10-5g·mm-2h-1.
    Development of a Piezoelectric Immunosensor for the Detection of Factor B
    LIU Li-Jia, HU Ji-Ming, PEI Ren-Jun, HU Yi
    1999, 20(6):  887-889. 
    Asbtract ( )   PDF (161KB) ( )  
    Related Articles | Metrics
    Ahighly sensitive piezoelectric immunosensor has been developed for the detection of factor B. The sensor consists of an 9MHz piezoelectric crystal with an antibody on its gold electrodes surface that selectively interacts with the relative antigen. The method of immobilization of the antibody protein with polyethyleneimine adhesion and glutaraldehyde crosslinking was employed. The immobilization methods gave the good results in terms of sensitivity, stability and reproducibility. The influence factors related to the sensitivity of the system such as the titer of antibody, the reaction time of immunoreaction etc., were discussed. Under the optimized experimental conditions chosen, the coated crystal had a good response to Factor Bin the mass concentration range of 10-5-10-3g/L. This sensor had a good selectivity, other materials in human serum did not interfere the detection remarkably. The recovery of sensor system is about 82%. The crystal could be regenerated by desorption of the bound antigenwith 0.2 mol/Lethanolamine(pH=8). The sensor could be reused nearly 6 times without detectable loss of activity.
    Studies on Crystal Structure, Conformation Analysis of a New Designed Hapten Containing Sulfur
    XIE Gui-Yang, KONG Ya-Li, WANG Jun-Mei, XU Xiao-Jie, JIN Sheng
    1999, 20(6):  890-894. 
    Asbtract ( )   PDF (226KB) ( )  
    Related Articles | Metrics
    The crystal structure of a new designed hapten N-benzoyl tauryl phenylalanine was studied by XRD . The results showed that the configuration of sulfur atom is tetrahedron,-SO2NH-is close to transition state of amide hydrolysis and there are severa LIN termolecular hydrogen bonds. The crystal structure was optimized by Molgen program, and then compared with the hapten that contain phosphorus. The conformation analysis of N-S-C and N-P-C bonds showed that N-S-C had only one single low energy conformer. Their charges were also calculated by MOPAC program(AM1 calculation), and it is found that the charge distribution around Satom is very close to that of the Patom. Those results showed that the molecule could be used to induce antibodies with CPA activity.
    Studies on the Syntheses of 3-(β-D-Xylopyranosyl)pyridazine and 3-(β-D-Xylopyranosyl)-4,5-dihydro-1H-6-pyridazinone
    SUN De-Qun, ZU Jing, MA Ling-Tai, ZHANG Li-He
    1999, 20(6):  895-899. 
    Asbtract ( )   PDF (1016KB) ( )  
    Related Articles | Metrics
    New Cnucleoside analogues were synthesized via the key intermediate 2-(2',3'4'-tri-O-benzoyl-β-D-xylopyranosyl)-furan. The stability of the α-and β-isomer was described. The conversion of the furan ring into pyridazine ring was performed by Clauso-Kaas method to give 3-(β-D-xylopyranosyl)pyridazine and 3-(β-D-xylopyranosyl-4,5-dihydro-6(1H)-pyridazinone.
    Synthesis of 1,3-Bis(9-O-quininyl)isophthalate and Its Preliminary Study in the Asymmetric Dihydroxylation of Olefins
    ZHANG Ke-Sheng, SUN Jun-Tan, HE Bing-Lin
    1999, 20(6):  900-902. 
    Asbtract ( )   PDF (533KB) ( )  
    Related Articles | Metrics
    1,3-Bis(9-O-quininyl)isophthalate(BQIP) was synthesized from quinine and isophthaloyl dichloride directly. High enantioselectivity and reactivity have been achieved in asymmetric dihydroxylation of transstilbene using BQIP as catalyst(optical yield: 99%), and lower enantioselectivity to styrene was obtained(optical yield: 84.3%). It can be deduced that the chiral cage in BQIP could bind transstilbene more firmly than styrene. Low reaction temperature brought about higher enantioselectivity than that of the high one.
    Studies on the Adsorption of Bilirubin by Adsorbents
    YUAN Zhi, WEI Bin, HE Bing-Lin, GU Han-qing
    1999, 20(6):  903-905. 
    Asbtract ( )   PDF (440KB) ( )  
    Related Articles | Metrics
    Polymeric adsorbents containing aminogroup for bilirubin were synthesized and the factors affecting the adsorption were also studied. The results show that the adsorption efficiency for bilirubin is over 80% in aqueous phosphate buffer, and 50% in the presence of bovine serum albumin within 2h. The hemocompatibility of adsorbents is good. So it is hopeful to be used in the hemoperfusion.
    Synthesis, Spectra and Stereochemistry of β-Lactam Derivatives of 1,5-Benzothiazepines
    LI Yuan, DU Cai-Yun, YANG Qiu-Qing, JIN Sheng, XING Qi-yi
    1999, 20(6):  906-908. 
    Asbtract ( )   PDF (167KB) ( )  
    Related Articles | Metrics
    Five title compounds were synthesized, their spectra and steric structures have been studied. The result reveals that the conformation of these compounds is chair-like, the chloro and phenyl substituents on C-2 and C-3 are cis to the fourmembered ring, the reaction of 1,5-benzothiazepine with chloroacelyl chloride is stereospecific reaction.
    Influence of Adding SiO2into ZrO2on SO42-/ZrO2Solid Superacid
    ZHANG Feng, HUA Wei-Ming, GAO Zi
    1999, 20(6):  909-913. 
    Asbtract ( )   PDF (527KB) ( )  
    Related Articles | Metrics
    Aseries of SO42-/ZrO2SiO2catalysts with different SiO2amount were prepared by coprecipitation and coating methods. The effect of adding SiO2into ZrO2on the crystallization, surface area, sulfur content, superacidity of SO42-/ZrO2and cumene cracking and iso-propanol dehydration was studied in detail. Adding SiO2into ZrO2retarded the crystallization and phase transformation of ZrO2, and decreased solid superacidity of SO42-/ZrO2, but enhanced the catalytic activities of SO42-/ZrO2for cumene cracking and isopropanol dehydration.
    Influence of Metal Salt on Molecular Structure of Water-soluble Rhdium-phosphine Complex
    YUAN You-Zhu, ZHANG Yu, YE Jian-Liang, LIAO Xin-Li, YAO Chun-Xiang, YANG Yiquan, TSAI Khi-Rui
    1999, 20(6):  914-917. 
    Asbtract ( )   PDF (586KB) ( )  
    Related Articles | Metrics
    The molecular structure of water-soluble phosphine-rhdium complex HRh(CO)(TPPTS)3[TPPTS:P(m-C6H4SO3Na)3]affected by the metal salts, e.g., NaCl, NiSO4, CuSO4, Fe2(SO4)3and Cr2(SO4)3was investigated in connection with the biphasic catalysis system by means of high resolution liquid NMR. No evident change in the spectra of 31P(1H)NMR and 1HNMR of the watersoluble complex was observed by addition of NaCl and NiSO4.When CuSO4was added into the complex, however, the peak intensity of 1HNMR due to HRh diminished and accompanied with the gradual disappearance of the phosphorus species of the complex and the appearance of the newborn phosphorus species in the 31P(1H)NMR spectra. Moreover, the characteristic twin signals of the complex at δ=44.8, 43.6 in the 31P(1H)NMR were completely replaced by the new complexes at δ =28.0-33.4 when Fe2(SO4)3was added. The similar result was obtained in the case of Cr2(SO4)3, when higher concentration of Cr2(SO3)4was used. The results obtained shown that a decreasing order of influence of salt on the molecular structure of the complex is: Fe2(SO4)3>Cr2(SO3)4>CuSO4NiSO4~NaCl.
    Studies on the Structures, Infrared Spectra and Thermodynamic Properties of N-Fluo, N-Chloro and N-Methylsuccinimide by Using Density Functional Method
    GONG Xue-Dong, XIAO He-Ming
    1999, 20(6):  918-922. 
    Asbtract ( )   PDF (215KB) ( )  
    Related Articles | Metrics
    Density functional theory(DFT) with the B3LYPmethod and 6-31G*basis set has been employed to investigate the geometries, electronic structures, infrared spectra and thermodynamic properties of N-fluo, N-chloro and N-methylsuccinimide(abbreviated as SIMF, SIMCl and SIMMe, respectively) in gasphase, the effect of substituents on the above properties is discussed. It is shown that SIMF and SIMCl are planar, SIMMe is essentially planar. The C=O stretch vibration(C=O) splits into two bands at 1734-1771 and 1792-1822 cm-1respectively, and the low frequency band has much stronger intensity than the high one. Compared with SIM, electron withdrawing group(F or Cl) makes the C=O and dipole moment larger, while electron contributing group has an opposite effect. The standard thermodynamic functions, i.e., entropy(S°) and heat capacity(Cp°), have been derived with the scaled computed frequencies.
    Electrochemical and in situ FTIR Spectroscopic Studies of CO2Reduction on Polycrystalline Rh Surface
    HONG Shuang-Jin, ZHOU Zhi-You, SUN Shi-Gang, SHAO Guo-Qiang, QU Ze-Tang
    1999, 20(6):  923-927. 
    Asbtract ( )   PDF (1390KB) ( )  
    Related Articles | Metrics
    The reduction of carbon dioxide on polycrystalline Rh electrode is studied by using programmed potential sweep method and in situ FTIR spectroscopy. Emphases are laid on the study of surface processes involved in the reduction. The adsorbed species derived from CO2reduction (r-CO2) have been determined by in situ FTIR as bridge(COB) and linear(COL) bonded CO, which yield IRabsorption bands respectively around 1905 and 2020cm-1. The onset potential of CO2reduction has been determined at -0.05 V. The programmed potential sweep experiments demonstrated that the oxidation of r-CO2occurred in a current peak at about 0.36 V, from which the charge of r-CO2oxidation(Qox) has been measured quantitatively. It has been revealed that the Qoxvaries with the potential(Er) and the time(tr) applied for CO2reduction. At a given tr, Qoxincreases along with the decrease of Erfrom -0.15 V to -0.40 V. At each Er, Qoxreaches its saturation value (Qoxs) when tris longer than 250s. In comparison with the oxidation charge(498μCcm-2) for a saturation adsorption of CO on Rh electrode, the small value of Qsox(e.g., 270 Ccm-2even for Erat -0.40 V) indicates that the quantity of adsorbed CO species produced in CO2reduction is far from that of a monolayer coverage. The ratio of the intensity of IRband of bridge bonded COto that of linear bonded CO is served to figure out the surface site occupancy by r-CO2.In considering that the number of surface site occupied by bridge and linear bonded CO is 2 and 1 respectively, the surface site occupancy by r-CO2has been evaluated at only 73% for CO2reduction at -0.25V for 600 s. It has been demonstrated that the subsequent adsorption of COon the 27% vacancy surface sites yields mainly linear bonded COspecies, implying that the reduction of a CO2molecule may need the assistance of a few adjacent surface sites. The in situ FTIRresults also confirmed that the submonolayer of r-CO2is in a uniform distribution over Rh electrode surface. Finally, a reduction mechanism of CO2on Rh electrode has been proposed based on results of both programmed potential sweep method and in situ FTIR spectroscopy, in which the hydrogen adsorption is considered as an important step assisting the reduction.
    Timeparameter Method(Ⅳ) Studies on Thermokinetics for Opposite Reaction
    CHEN Yong, JIANG Fu-Bin, XIE Jia-Qing, ZHANG Yuan-Qin, ZENG Xian-Cheng
    1999, 20(6):  928-932. 
    Asbtract ( )   PDF (339KB) ( )  
    Related Articles | Metrics
    According to the theoretical basis of thermokinetics and the general kinetic equation of opposite reaction, a novel thermokinetic research method, time-parameter method for opposite reaction, was proposed in this paper. The rate constants of forward and backward reactions and equilibrium constant can be calculated from the same thermoanalytical curve simultaneously with this method. In order to test the validity of this method, the proton-transfer reactions of nitroethane with ammonia at 15℃ and 25℃, and with hydroxymethyl aminomethane(Tris) at 15℃ and 30℃ have been studied, respectively. The results of rate constants and equilibrium constants calculated by using this method are in agreement with those in literatures.
    Enthalpy Interaction Parameters of Glucose with Some Alcohols in Formamide
    TANG Qing-HU, LU Yan, BAI Tong-Chun, LU Jin-Suo
    1999, 20(6):  933-936. 
    Asbtract ( )   PDF (1304KB) ( )  
    Related Articles | Metrics
    The molar enthalpies of glucose solution, in the mixtures of some alcohols and formamide(FA), have been determined at 298.15K by using a C-80 colarimeter. The McMillan-Mayer theory was used to relate the excess enthalpies of the system to a series of pair and triplet interaction parameters. From the experimental results, the values of pair and triplet interaction parameters hXY, hXYY, hXXY between solutes have been fitted by a least square method.The information about the solute-solute interaction and the effect of solvent on the interaction were discussed.
    Studies on Surface Photovoltaic Properties of Palladium Tetramethyltetraethyl Porphyrin
    XIE Teng-Feng, WANG De-Jun, WANG Ying, LI Tie-Jin, WANG Jin
    1999, 20(6):  937-940. 
    Asbtract ( )   PDF (186KB) ( )  
    Related Articles | Metrics
    The surface photovoltaic properties of tetramethyltetraethyl porphyrin(TMTEP) and palladium tetramethyltetraethyl porphyrin(PdTMTEP), which was synthesized by using improving technique, was studied by surface photovoltage spectra(SPS) and field induced surface photovoltage spectra(FISPS). The photovoltaic response intensity of PdTMTEPis much stronger than that of TMTEPsince PdTMTEP shows a strong phosphorescence and weak fluorescence. The photovoltaic response intensity of Soret band and Q band for PdTMTEP are enhanced with an external positive electric field and weakened with a negative electric field. Moreover, two new photovoltaic response bands appear at 680 and 750 nm, which are related to the transition of polaron.
    Studies on Vibrational Spectra and Normal Coordinate Analysis of Hexabrominedisilane
    XU Xue-Jun, XUE Ying, XIE Dai-Qian, YAN Guo-Sen
    1999, 20(6):  941-944. 
    Asbtract ( )   PDF (188KB) ( )  
    Related Articles | Metrics
    The optimized geometries, infrared intensities, Raman activities and fundamental vibrational frequencies and PEDs are reported for D3dsymmetry of Si2Br6utilizing HF/6-31G*and B3LYP/6-31G*method. The predicted value of Si-Si torsional vibrational frequency is given. Anormal coordinate analysis has been carried out and HF force field is scaled with scale factor of 0.9 pertinent to all vibrational modes. The average error between the predicted frequencies obtained from HF/6-31G*SQM force field and the observed fundamental vibrational frequencies is 9.4cm-1; the average error between the predicted value from unrefined DFTforce field and the observed result is 8. 6cm-1. The fundamental vibrational frequencies obtained from DFT alculation with B3LYP/6-1G*are in good agreement with the experimental results.
    Theoretical Study of the Innersphere Reorganization Energy and Activation Energy of Selfexchange Electron Transfer Reaction for M(H2O)62+/3+(M=V, Cr, Mn, Fe and Co) Systems
    ZHANG Dong-Ju, LI Lin-Wei, FENG Da-Cheng, BU Yu-Xiang, LIU Cheng-Bu
    1999, 20(6):  945-950. 
    Asbtract ( )   PDF (1549KB) ( )  
    Related Articles | Metrics
    The activation model and reorganization model of electron transfer process are presented respectively in terms of the definitions of activation energy and reorganization energy. A new method is presented for calculating the innersphere activation energy and reorganization energy of selfexchange electron transfer reaction between transition metal complexes in aqueous solution by using Ab initio calculation. Ab initio calculations are applied to low-lying state M(H2O)62+/3+(M=V, Cr, Mn, Fe and Co) system at the UMP2 level using 6-311G basis set. The innersphere reorganization energy and activation energy of these reaction systems in the electron process are obtained and are in good agreement with prediction of Marcus electron transfer theory.
    Experimental Observation of the Dependence of 240nm Central Spectral Region in the Third Continuum of Argon on Pressure
    GAO Shao-Hong, ZHAO Yong-Peng, LIU Jin-Cheng, WANG Qi
    1999, 20(6):  951-953. 
    Asbtract ( )   PDF (179KB) ( )  
    Related Articles | Metrics
    Using high current relativistic electron beam to pump pure argon transversely, the dependence of 240 nm central spectral region in the third continuum of argon on pressure is observed, which indicates that 3×105Pa is the optimal pressure in producing this central spectral region, and proves that this central spectral region arises from the charged clusters.
    Influence of Cr Content on Catalytic Oxidation Active in MCM-48 Catalyst
    WEI Chang-Ping, CAI Qiang, LIU Yan, ZHEN Kai-Ji, BI Ying-Li, PANG Wen-Qin
    1999, 20(6):  954-956. 
    Asbtract ( )   PDF (491KB) ( )  
    Related Articles | Metrics
    Aseries of MCM-48 contained chromium mesoporous molecular sieve, prepared by hydrothermal crystallization and characterized by IR, Py-IR, XRD and TG-DTA, were used to catalyze the oxidation of octadecanol and eicosanol to the corresponding acid. The evaluation of the catalytic properties indicated that Cr content affected the catalytic oxidation activity. The catalyst with 5%Cr gave the highest yield of α-octadecanoic acid and eicosanic acid. Depending on the amount Lewis acid sites in the samples, the reaction products were monitored by using IR technique, and the obtained results were consistent with that of chemical analysis.
    High Resolution Matrix-assisted Laser Desorption/Ionization Time-of-flight Mass Spectrometry Analysis of DNA
    DENG Hui-Min, LI Jun, LAI Zhi-Hui, ZHA Qing-Min, ZHAO Shan-Kai
    1999, 20(6):  957-959. 
    Asbtract ( )   PDF (152KB) ( )  
    Related Articles | Metrics
    High resolution mass spectra of DNAs amples were acquired by using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry(MALDI-TOF-byMS) using mixture of 3-hydroxypiclinic acid and picnilic acid as a matrix. The resolutions of d(C)10, d(G)10, d(T)18, and d(TTACTCTGTTAATGTCTTTG) mono-isotope peaks have reached 5513, 3895, 10468 and 8769 respectively. The experiment results showed that the DNA samples with a higher purity and stability could get higher resolutions. C18Sep-Pak cartridge, NH4+cation-exchange resin and nitrocellulose(NC) film substrate have been applied to eliminating Na+, K+ions and other impurities from DNA syntheses, and to purifying the analytes and obtaining high resolution mass spectra with enhanced sensitivity and reproducibility.
    Ab Initio Study on Stability of Tetratomic Beryllium Borides Clustres
    XU Xiao-Honga, WU Hai-Shun, ZHANG Cong-Jie, WANG Yong-Lan, JIN Zhi-Hao
    1999, 20(6):  960-962. 
    Asbtract ( )   PDF (493KB) ( )  
    Related Articles | Metrics
    Forty-six electronic states of 23 geometric configurations for beryllium borides BBe3, B2Be2and B3Be have been optimized at HF/6-31G*level by using ab initio method. Based on optimized results, total energies and vibrational frequencies are calculated. It is shown that the ground states of BBe3, B2Be2and B3Be are 1f(2A1), 2h(1A1) and 3e(2A1) respectively.
    Polymer-supported Palladium-based Bimetallic Catalysts for the Oxidative Carbonylation of Aniline
    WAN Bo-Shun, LIAO Shi-Jian, YU Dao-Rong
    1999, 20(6):  963-964. 
    Asbtract ( )   PDF (284KB) ( )  
    Related Articles | Metrics
    Polymer-supported bimetallic catalyst PVP-PdCl2-MnCl2[PVP=poly(N-vinyl-2-pyrrolidone] exhibits a high activity and selectivity for the oxidative carbonylation of aniline to carbamate ester under atmospheric pressure [v(CO)/V(O2)=10/1]. A remarkable bimetallic synergic effect in PVP-PdCl2-MXn(M: second transition metal) gives rise to an obvious increase in the conversion and selectivity for the reaction in the presence of a base(NaOAc). Among the Mcomponents tested, Mn-Pd exhibits the strongest synergic effect.
    Preparation of New Adsorbent for Bilirubin by Immobilizing Guanidine on Cross-linked Polyvinyl Alcohol Gel
    ZHANG Ke-Sheng, SUN Jun-Tan, HE Bing-Lin
    1999, 20(6):  965-968. 
    Asbtract ( )   PDF (427KB) ( )  
    Related Articles | Metrics
    Anew adsorbent for bilirubin was prepared by immobilizing guanidine on cross-linked polyvinyl alcohol gel. It possesses good adsorption performance for bilirubin both in albuminfree and albumin solutions. The adsorption efficiency increases with the decrease of the crosslinking degree of PVA, the ratio of albumin to bilirubin and ion concentration. The increase of the guanidine amount can improve the adsorption performance.
    Relationship Between Breakdown of Time-temperature Superposition Principle and Phase-separation for PMMA/α-MSAN Blends
    ZHENG Qiang, TAKAHASHI Masaoki, MASUDA Toshiro
    1999, 20(6):  969-973. 
    Asbtract ( )   PDF (609KB) ( )  
    Related Articles | Metrics
    By examining superposition of viscoelastic functions of poly(methyl methacrylate)(PMMA)/poly(α-methylstyrene-co-acrylonitrile)(α-MSAN) blends, we found that breakdown of time-temperature superposition principle in the long time relaxation region(terminal region) is related to phaseseparation of this blends. Heterogeneity in the blends results in the relationship between dynamic storage modulus G′(or dynamic loss modulus G″) and frequency in the terminal region no longer obey the model of linear viscoelasticity. It is interesting that there exists temperature dependence of this breakdown. This breakdown temperature(Td) can be used as a criterion for phaseseparation of the blends and was considered superior to socalled critical temperature(Tb) obtained by plotting of lgG′vs. lgG″.
    Synthesis and Invitro Bloodcompatibility of Polyurethane Modified by Amino Acid
    JI Jian, JI Ren-Tian, QIU Yong-Xing, CHEN Bao-Lin, FENG Lin-Xian
    1999, 20(6):  974-977. 
    Asbtract ( )   PDF (413KB) ( )  
    Related Articles | Metrics
    Anew reactive graft copolymer, polyurethane-graft-w-propyl sodium sulfonatepoly(ethylene glycol)(PEU-g-PEO-SO3-Na+), was synthesized by PTMG-g-PEO-SO3-Na+, MDI and 1,4-butanedioL IN two steps. Two amino acids (L-lysine and L-tyrosine) were covalently attached to the copolymer after converting the sulfonate group to sulfonyl chloride. The structure of the resuting polyurethanes were characterized by IRand UV. The polyurethane modified by L-lysine and L-tyrosine can resist both platelet adhesion and thromb formation.
    Stability of the GHD Latex Crosslinkable at Ambient Temperature
    YU Zhang-Qing, LI Bo-Geng, LI Bao-Fang, PAN Zu-Ren
    1999, 20(6):  978-983. 
    Asbtract ( )   PDF (667KB) ( )  
    Related Articles | Metrics
    The GHD latex containing glycidyl methacrylate(GMA), hydroxyl methacrylate(HEMA) and dimethylaminoethyl methacrylate(DMAEMA), which is crosslinkable at ambient temperature, was synthesized. In the presence of the seed latex of methyl methacrylate(MMA)-butyl acrylate(BA)-GMA, the effects of the polymerization technology and the recipes on the process stability of the emulsion copolymerization(PSEC) of MMA-BA-HEMA-DMAEMA and the shelf life of the crosslinkable latex obtained were studied. PSEC and the shelf life are improved as more emulsifier is used. When the polymerization temperature is raised, PSEC becomes worse because the crosslinking coagulation is increased, but the shelf life of the latex becomes longer because of the smaller particles and the lower surface tension. Raising Tg of the seed polymer can depress the crosslinking coagulation during the copolymerization and improve PSEC. Increasing the content of HEMA and DMAEMA has little influence on PSEC but it reduces the shelf life of the latex. When the functional group is separated through the particle designing, the latex with acceptable shelf life is obtained. It was deduced that the crosslinking coagulation may be the key factor which determined the PSEC and the shelf life of the latex crosslinked at ambient temperature.
    Preparation of Polymeric Nanoparticles and Observa tion on the Structure of Novel Nanosized Physical Hydrogels by AFM and SEM Methods
    ZHAO Yi-Qiang, MING Wei-Hua, HU Jian-Hua, FU Shou-Kuan, LI Min-Qian, CHEN Sheng-Fu, XIONG Qi-Hua
    1999, 20(6):  984-986. 
    Asbtract ( )   PDF (1486KB) ( )  
    Related Articles | Metrics
    A series of novel nano-sized physical hydrogels based on the hydrophobic polymeric nanoparticles have been prepared via a modified microemu lsion polymerization, which may contain as much as above 90% water with nanosized particle diameter of about 20nm. The specific structures of the prepared hydrogels were observed successfully by A tomicForce Microscope (AFM) and Scanning Electron Microscope (SEM). The micrograph s showed that the polymeric nanoparticles and their aggregated clusters were connected to form the networks of hydrogels, in which water including free water and bound water were embedded. The formation mechanism of the hydrogel has also been discussed in th is paper. Keywords N anoparticle, Physical hydrogel.
    Studies on Alcohol Permselective Performanceof a Novel Composite Membrane
    WANG Xin-Ping, FENG Yun-Fang, SHEN Zhi-Quan, ZHANG Yi-Feng
    1999, 20(6):  987-989. 
    Asbtract ( )   PDF (442KB) ( )  
    Related Articles | Metrics
    In this paper, preferential separation of ethanol from aqueous solution through a novel composite chitoan membrane has been investigated for the first time. This novel composite membrane has a threelayer structure. The top layer is a thin dense film of chitosan, and the support layer is microporous polyacrylonitrile(PAN). Between the dense and microporous membrane, there is an intermolecular crosslinking layer. The results show that the novel composite membrane preferentially permeate ethanol at lower ethanol concentration in feed when it has been prepared under proper conditions. The membrane gives a separation factor of 6.8 and a flux of 900gm-2h-1at 5%(mass fraction) of ethanoL IN the feed at 20℃ .
    Studies on Synthesis and Degradation Properties of Polyanhydrides with HexestroLIN the Backbone
    ZHOU Chuan-Jun, FAN Chang-Lie, HU Yun-Hua, ZHUO Ren-Xi
    1999, 20(6):  990-992. 
    Asbtract ( )   PDF (189KB) ( )  
    Related Articles | Metrics
    Polymeric drug containing active agent in the backbone was one of the controlled release systems. In this paper, some polymers, which have an antineoplastic agent(hexestrol) in the backbone, have been synthesized by copolymerization hexestrol bis(hydrogen succinate) with sebacic acid(SA). Hexestrol bis(hydrogen succinate) was prepared by reaction hexestrol with succinic anhydride. The degradation properties in vitro under various pHconditions were also investigated. The results showed that the degradation rates increase with the increase of pH, and at the same time, the degradation rates increase with the increase in sebacic acid content in the copolymers.
    Synthesis of an Amphiphilic BifunctionaL INitiatorwith an Aromatic Group
    ZHOU Guang-Chang, HUANG Peng-Cheng, ZHU He-Sun
    1999, 20(6):  993-995. 
    Asbtract ( )   PDF (434KB) ( )  
    Related Articles | Metrics
    An amphiphilic bifunctionaLINitiator with an aromatic group, which is used in free radicaLINterfacial copolymerization, p-toluoyl(3-carboxypropionyl)sebacoyl diperoxide(MBSD), was synthesized by the successive condensation of sebacoyl chloride with p-methylperoxybenzoic acid and monoperoxysuccinic acid under the catalysis of pyridine and further characterized by IR, 1HNMR, MS, elemental analysis and the analysis of peroxide oxygen content.