Chem. J. Chinese Universities ›› 1999, Vol. 20 ›› Issue (6): 957.

• Articles • Previous Articles     Next Articles

High Resolution Matrix-assisted Laser Desorption/Ionization Time-of-flight Mass Spectrometry Analysis of DNA

DENG Hui-Min, LI Jun, LAI Zhi-Hui, ZHA Qing-Min, ZHAO Shan-Kai   

  1. Instrumental Analysis & Research Center, Zhongshan University, Guangzhou, 510275
  • Received:1999-01-23 Online:1999-06-24 Published:1999-06-24

Abstract: High resolution mass spectra of DNAs amples were acquired by using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry(MALDI-TOF-byMS) using mixture of 3-hydroxypiclinic acid and picnilic acid as a matrix. The resolutions of d(C)10, d(G)10, d(T)18, and d(TTACTCTGTTAATGTCTTTG) mono-isotope peaks have reached 5513, 3895, 10468 and 8769 respectively. The experiment results showed that the DNA samples with a higher purity and stability could get higher resolutions. C18Sep-Pak cartridge, NH4+cation-exchange resin and nitrocellulose(NC) film substrate have been applied to eliminating Na+, K+ions and other impurities from DNA syntheses, and to purifying the analytes and obtaining high resolution mass spectra with enhanced sensitivity and reproducibility.

Key words: Matrix-assisted laser desorption ionization, DNA, High resolution mass spectrometry

CLC Number: 

TrendMD: