Novel Microfluidic Droplet Digital PCR Chip for High Sensitive Detection of Nucleic Acid†

doi:10.7503/cjcu20170012

Abstract

Abstract:

Sensitive and rapid quantification of nucleic acid is significant for clinical diagnosis and medication guide of tumor. In this study, we developed a novel droplet digital PCR(ddPCR) device for sensitive nucleic acid detection. This chip contains a PDMS chip and glass-made reservoir, which can overcome the problems of droplet evaporation and instability during PCR. The double droplet generation channels in this chip can produce 2×10⁶ droplets(4.187 pL each) in 25 min. For detecting EGFR exon 19 wild-type DNA using this ddPCR chip, it demonstrated a good linear correlation with the DNA concentration from 10 to 10⁶ copies/μL(R²=0.9998). In addition, we show sensitive detection of EGFR exon 19 mutate DNA in a 10⁶-fold excess of wild-type background. In conclusion, this ddPCR chip integrates the functions of droplet generation, on-chip PCR process and fluorescence signals readout, which will provide a potential application in the absolute nucleic acids quantification and rare mutate gene detection.

Key words: Digital PCR, Microfluidic chip, Micro-droplet, High sensitive nucleic acid detection

CLC Number:

O655.9

TrendMD:

YUAN Haojun, GAO Wanlei, JING Fengxiang, LIU Songsheng, ZHOU Hongbo, JIA Chunping, JIN Qinghui, ZHAO Jianlong. Novel Microfluidic Droplet Digital PCR Chip for High Sensitive Detection of Nucleic Acid^†[J]. Chem. J. Chinese Universities, 2017, 38(7): 1140.

Figures/Tables 8

Fig.1 Design and operation of ddPCR device(A) Schematic representation of the ddPCR device; (B) structure of the PDMS chip(inset shows the generation of droplets under the microscope); (C) an image of the fabricated ddPCR chip.

Table 1 DNA sequences of primers and MGB probe

Sample	Sequence(5'—3')
Forward primer	atcccagaaggtgagaaagt
Reverse primer	tgtggagatgagcagggtct
MGB probe	HEX-aagccaacaaggaaatc-MGB; FAM-agatgttttgatagcgac-MGB

Fig.2 Bright-field images of the droplets after amplification in PDMS reservoir(A) and in glass reservoir of this ddPCR chip(B)

Fig.3 Plots of droplet diameter with various oil pressures(A) and water pressures(B) Error bars represent the standard deviation of droplet diameter.

Fig.4 Fluorescent images for simultaneous detection of EGFR gene19 exon with various

Fig.5 Measured value in the ddPCR assay against its expected valueError bars depict 95% confidence interval.

Fig.6 Detection of the EGFR exon19 rare mutant(0—0.01%) in the presence of wild type DNA by droplet digital PCR (A1—A4) Hex channel; (B1—B4) Fam channel. Rare mutant: (A1, B1) 0%; (A2, B2) 0.0001%; (A3, B3) 0.001%; (A4, B4) 0.01%.

Fig.7 Detection of the EGFR exon19 rare mutant(0.1%—100%)in the presence of wild type DNA by droplet digital PCR (A1—A4) Hex channel; (B1—B4) Fam channel. Rare mutant: (A1, B1) 0.1%; (A2, B2) 1%; (A3, B3) 10%; (A4, B4) 100%.

References 33

[1]	Kalinina O., Lebedeva I., Brown J., Silver J., Nucleic Acids Research,1997, 25(10), 1999—2004
[2]	Vogelstein B., Kinzler K. W., Proceedings of the National Academy of Sciences of the United States of America,1999, 96(16), 9236—9241
[3]	Zhong Q., Bhattacharya S., Kotsopoulos S., Olson J., Taly V., Griffiths A. D., Link D. R., Larson J. W., Labona Chip,2011, 11(13), 2167—2174
[4]	Courtois F., Olguin L. F., Whyte G., Bratton D., Huck W. T. S., Abell C., Hollfelder F., Chem. Bio. Chem., 2008, 9(3), 439—446
[5]	Hatch A. C., Fisher J. S., Pentoney S. L., Yang D. L., Lee A. P., Labona Chip,2011, 11(13), 2509—2517
[6]	LermoA., Zacco E., Barak J., Delwiche M., Campoy S., Barbe J., Alegret S., Pividori M. I., >Biosensors & Bioelectronics,2008, 23(12), 1805—1811
[7]	Zhao Y. N., Petraitiene R., Walsh T. J., Perlin D. S.,J. Clinical Microbiology,2013, 51(3), 1034—1036
[8]	Higuchi R., Fockler C., Dollinger G., Watson R., Nature Biotechnology,1993, 11(9), 1026—1030
[9]	Yin J. L., Shackel N. A., Zekry A., Mcguinness P. H., Richards C., Putten K. V. D., Immunology & Cell Biology,2001, 79(3), 213—221
[10]	Blotta I., Prestinaci F., Mirante S., Cantafora A., Annali Dellistituto Superiore Di Sanita,2005, 41(1), 119—123
[11]	Mikael K. A., José M. A. B., Martin B. A., Ami F. D., Jiri J. E., Kristina L. A., Molecular Aspects of Medicine,2006, 27(27), 95—125
[12]	Houssin T., Cramer J., Grojsman R., Bellahsene L., Colas G., Moulet H., Lab on a Chip,2016, 16(8), 1401—1411
[13]	Moschou D., Vourdas N., Kokkoris G., Papadakis G., Parthenios J., Chatzandroulis S., Sensors & Actuators B: Chemical,2014, 199(4), 470—478
[14]	Hindson C. M., Chevillet J. R., Briggs H. A., Gallichotte E. N., Ruf I. K., Hindson B. J., Nature Methods,2013, 10(10), 1003
[15]	Dingle T. C., Sedlak R. H., Cook L., Jerome K. R., Clinical Chemistry,2013, 59(11), 1670—1672
[16]	Lynch T. J., Adjei A. A., Jr B. P., Eisen T. G., Engelman J., Goss G. D., Clinical Cancer Research,2006, 12(2), 4365s—4371s
[17]	Lynch T. J., Bell D. W., Sordella R., Gurubhagavatula S., Okimoto R. A., Brannigan B. W., New England Journal of Medicine,2004, 350(350), 2129—2139
[18]	Ciardiello F., Tortora G., New England Journal of Medicine,2008, 358(11), 1160—1174
[19]	Sharma S. V., Bell D. W., Settleman J., Haber D. A., Nature Reviews Cancer,2007, 7(3), 169—181
[20]	Rebecca C. H., Alissa G., Tinsley S., David L., Lynn H., Michelle F., Phil B., Jeanne H., Zheng L., PLoS One,2013, 8(8), e73068
[21]	Hatch A. C., Fisher J. S., Tovar A. R., Hsieh A. T., Lin R., Pentoney S. L., Lab on a Chip,2011, 11(22), 3838—3845
[22]	Courtois F., Olguin L. F., Whyte G., Bratton D., Huck W. T. S., Abell C., Chem. Bio. Chem., 2008, 9(3), 439—446
[23]	Taly V., Pekin D., El A. A., Laurent-Puig P., Trends in Molecular Medicine,2012, 18(7), 405—416
[24]	Ma J., Li N., Guarnera M., Feng J., Biomarker Insights,2013, 8(8), 127—136
[25]	Pornprasert S., Prasing W., European Journal of Haematology,2014, 92(3), 244—248
[26]	Thorsen T., Maerkl S. J., Quake S. R., Science,2002, 298(5593), 580—584
[27]	Dressman D., Yan H., Traverso G., Kinzler K. W., Vogelstein B. , Proc. Natl. Acad. Sci. USA,2003, 100(15), 8817—8822
[28]	Shigematsu H., Gazdar A. F., International Journal of Cancer,2006, 118(2), 257—262
[29]	Nakano M., Komatsu J. S., Takashima K., Katsura S., Mizuno A., J. Biotec., 2003, 2(2), 117—124
[30]	Bian X. J., Jing F. X., Li G., Biosensors and Bioelectronics,2015, 74, 770—777
[31]	Mazutis L., Araghi A. F., Miller O. J., Baret J. C., Frenz L., Janoshazi A., Analy. Chem., 2009, 81(12), 4813—4821
[32]	Heyries K. A., Tropini C., Vaninsberghe M., Doolin C., Petriv O. I., Singhal A., Nature Methods,2011, 8(8), 649—651
[33]	Kiss M. M., Ortoleva-Donnelly L., Beer N. R., Warner J., Bailey C. G., Colston B. W., Rothberg J. M., Link D. R., Leamon J. H. , Anal. Chem., 2008, 80(23), 8975—8981