Azithromycin-loaded Polydopamine Nanoparticles for the Treatment of Periodontitis

doi:10.7503/cjcu20240257

Abstract

Abstract:

By the coordination between dimethylimidazole and ZnNO₃·6H₂O， the dodecahedral ZIF-8 were prepared first. Using ZIF-8 as template and dopamine hydrochloride as raw material， polydopamine nanoparticles（PDA NPs） with hollow structure were then prepared by chelation competition induced polymerization（CCIP） method. Furthermore， by using PDA NPs as drug carrier， azithromycin loaded PDA NPs（AZM@PDA NPs） were finally prepared. The hollow structure of PDA NPs contributed to high azithromycin loading with a drug loading rate of up to 20.2%. AZM@PDA NPs have high biocompatibility and low cytotoxicity， and can promote the expression of anti- inflammatory cytokines in cells. The sustained release of azithromycin achieved by AZM@PDA NPs can effectively treat periodontitis and resist alveolar ridge resorption， with good biosafety in vivo and broad application prospects.

Key words: Azithromycin, Polydopamine, Drug loading, Sustained drug release, Treatment of periodontitis

CLC Number:

O631

TrendMD:

WANG Lu, YE Qiang, WANG Xiuli, ZHAO Mingcan, LI Yi, HOU Yuchuan. Azithromycin-loaded Polydopamine Nanoparticles for the Treatment of Periodontitis[J]. Chem. J. Chinese Universities, 2025, 46(1): 20240257.

Figures/Tables 10

References 21

1	Lamont R. J.， Koo H.， Hajishengallis G.， Nat. Rev. Microbiol.， 2018， 16（12）， 745—759
2	Kumar P. S.， J. Physiol⁃London， 2017， 595（2）， 465—476
3	Yamada C.， Ho A.， Garcia C.， Oblak A. L.， Bissel S.， Porosencova T.， Porosencov E.， Uncuta D.， Ngala B.， Shepilov D.， Skibo G.， Mascarenhas A. K.， Akkaoui J.， Lakshmana M. K.， Sankar U.， Nichols F.， Lamb B. T.， Groppa S.， Movila A.， J. Periodont. Res.， 2024， doi： 10.1111/jre.13227
4	Rajeshwari H. R.， Dhamecha D.， Jagwani S.， Rao M.， Jadhav K.， Shaikh S.， Puzhankara L.， Jalalpure S.， J. Control. Release， 2019， 307， 393—409
5	Herrera D.， Sanz M.， Kebschull M.， Jepsen S.， Sculean A.， Berglundh T.， Papapanou， P. N.， Chapple， I.， Tonetti， M. S.， J. Clin. Periodontol.， 2022， 49， 4—71
6	Tran X. V.， Ngo L. T. Q.， Boukpessi T.， Healthcare， 2021， 9（6）， 720
7	Shynkevych V. I.， Kolomiiets S. V.， Kaidashev I. P.， The Saudi Dental Journal， 2023， 35（8）， 929—938
8	Zafar M.， Jahan H.， Shafeeq S.， Nimtz M.， Jänsch L.， Römling U.， Choudhary， M. I.， Infect. Immun.， 2020， 88（11）， e00510—e00520
9	Jain N.， Lai P.， Walters J. D.， J. Periodontol.， 2012， 83（9）， 1122—1128
10	Amiri A.， Bagherifar R.， Dezfouli E. A.， Kiaie S. H.， Jafari R.， Ramezani R.， J. Transl. Med.， 2022， 20， 125
11	Bai L.， Phua S. Z. F.， Lim W. Q.， Jana A.， Luo Z.， Tham H. P.， Zhao L.， Gao Q.， Zhao Y.， Chem. Commun.， 2016， 52， 4128—4131
12	Liu S.， Zhang M.， Jin H.， Wang Z.， Liu Y.， Zhang S.， Zhang H.， J. Am. Chem. Soc.， 2023， 145（1）， 160—170
13	Schöttler S.， Becker G.， Winzen S.， Steinbach T.， Mohr K.， Landfester K.， Mailänder V.， Wurm F. R.， Nat. Nanotechnol.， 2016， 11， 372—377
14	Zhao P.， Liu S.， Wang L.， Liu G.， Cheng Y.， Lin M.， Sui K.， Zhang H.， Carbohyd. Polym.， 2020， 241， 116344
15	Qi S.， Lin M.， Qi P.， Shi J.， Song G.， Fan W.， Sui K.， Gao C.， Chem. Eng. J.， 2022， 444， 136541
16	Nicolas J.， Mura S.， Brambilla D.， Mackiewicz N.， Couvreur P.， Chem. Soc. Rev.， 2013， 42， 1147—1235
17	Liu S. W.， Jin H.， Yin W. Z.， Zhang H.， Chem. J. Chinese Universities， 2022， 43（8）， 20220345
	刘树威，晋皓，尹万忠，张皓. 高等学校化学学报， 2022， 43（8）， 20220345
18	Bordat A.， Boissenot T.， Nicolas J.， Tsapis N.， Adv. Drug Deliver. Rev.， 2019， 138， 167—192
19	Xiang S.， Qian H.， Chen Y.， Zhang K.， Shi Y.， Liu W.， Sun H.， Sun H.， Yang B.， Chem. Mater.， 2017， 29， 6536—6543
20	Tian M.， Zhou L.， Fan C.， Wang L.， Lin X.， Wen Y.， Su L.， Dong H.， Acta Biomater.， 2023， 158， 252—265
21	Sun B.， Zheng X.， Zhang X.， Zhang H.， Jiang Y.， ACS Omega， 2024， 9， 16676—16686

Gene		Primer sequence
IL⁃10	Forward	5'⁃ATGCTGCCTGCTCTTACTGACTG⁃3'
IL⁃10	Reverse	5'⁃CCCAAGTAACCCTTAAAGTCCTGC⁃3'
TGF⁃β	Forward	5'⁃CTTCAGCCTCCACAGAGAAGAACT⁃3'
TGF⁃β	Reverse	5'⁃TGTGTCCAGGCTCCAAATATAG⁃3'

Gene		Primer sequence
IL⁃10	Forward	5'⁃ATGCTGCCTGCTCTTACTGACTG⁃3'
IL⁃10	Reverse	5'⁃CCCAAGTAACCCTTAAAGTCCTGC⁃3'
TGF⁃β	Forward	5'⁃CTTCAGCCTCCACAGAGAAGAACT⁃3'
TGF⁃β	Reverse	5'⁃TGTGTCCAGGCTCCAAATATAG⁃3'

[1]	ZHANG Lu, ZOU Yunhe, XU Zhongsheng, LIU Yun. Hollow-structured Nanomaterials for Biomedical Applications： Current Development and Future Prospective [J]. Chem. J. Chinese Universities, 2023, 44(8): 20230134.
[2]	YU Pengdong, GUAN Xinghua, WANG Dongdong, XIN Zhirong, SHI Qiang, YIN Jinghua. Preparation and Properties of Novel Optical and Thermal Dual Response Shape Memory Polymers [J]. Chem. J. Chinese Universities, 2022, 43(6): 20220085.
[3]	SUN Qirui, ZHAO Nan, LIU Shuwei, XIN Hua, ZHANG Hao, ZHANG Lening. Polydopamine-coated Fe₃O₄/methylprednisolone/cyclophosphamide Superparticles for the Magnetic Targeting Treatment of Pulmonary Fibrosis [J]. Chem. J. Chinese Universities, 2021, 42(10): 3225.
[4]	WU Fengren,LIU Yongjia,LU Xuemin,ZHU Bangshang. Controllable Preparation of Polydopamine Modified Gold Nanoflowers and Its Application in Photothermal Therapy ^† [J]. Chem. J. Chinese Universities, 2020, 41(3): 465.
[5]	ZHANG Meng, WANG Shaosen, XIN Yuhao, LIU Xue, WU Qiuhua, ZHANG Guolin. Preparation and Drug Delivery Properties of Thermo/pH Dual Responsive Copolymer Composite Micelles of MPEG-b-PCL/PNVCL-b-PCL [J]. Chem. J. Chinese Universities, 2020, 41(12): 2822.
[6]	LIU Yun, LI Ting, WANG Yang, DONG Weifu. Preparation of Multi-scale Superhydrophobic Cotton/Polydopamine/Silica Composite for Selective Oil Absorption [J]. Chem. J. Chinese Universities, 2019, 40(8): 1775.
[7]	XIONG Zhengrong,DONG Li,LIU Xiangdong,YANG Yuming. Preparation and Properties Characterization of PDA/PVDF UV Shielding Composite Membranes [J]. Chem. J. Chinese Universities, 2019, 40(4): 849.
[8]	YANG Shuting, LI Qianhui, FAN Yuchang, WANG Qiuxian, DU Ting, YUE Hongyun. Li₄Ti₅O₁₂ Modification by Bifunctional Bionic Membrane as Anode Materials for Lithium-ion Batteries^† [J]. Chem. J. Chinese Universities, 2018, 39(11): 2513.
[9]	JIAN Yuhang, YAN Shifeng, LI Xing, HUANG Yanan, YIN Jingbo. Synthesis and Characterization of Injectable Hydrogels Based on Star β-CD-g-poly(L-glutamic acid) [J]. Chem. J. Chinese Universities, 2017, 38(8): 1489.
[10]	GUAN Qingxiang, ZHANG Guangyuan, SUN Dandan, SUN Shilin, SUN Cheng, LIU Xin, HAN Bing. Investigation on Synthesis of Bletilla Striata Polysaccharides Amphiphilic Polymer and Drug-loaded Delivery System^† [J]. Chem. J. Chinese Universities, 2016, 37(10): 1915.
[11]	LIU Yuwei, GUO Zhuo. Polydopamine-doxorubicin Colloidal Nanoparticles for Chemo-Photothermal Synergistic Therapy Against Cancer Cell^† [J]. Chem. J. Chinese Universities, 2015, 36(7): 1389.
[12]	MA Lina, LIU Fuyao, GAO Jiaxue, WANG Zhenxin. Polydopamine Nanoparticle-based Fluorescence Resonance Energy Transfer Assay for microRNA Detection^† [J]. Chem. J. Chinese Universities, 2015, 36(6): 1061.
[13]	YANG Bao-Chun, JIANG Yao-Dong, QIN Xue-Juan, CHEN Zhi-Liang, REN Fei. Loaded and in vitro Drug Release of Anticancer Drugs in Porous Metal-Organic Frameworks [J]. Chem. J. Chinese Universities, 2012, 33(01): 26.
[14]	YANG Ji^1,2, CAI Zheng¹, XIAN Dan¹, WANG Zheng¹*. Studies on the Property Opetimization of Poly(ether-anhydride) Gels and the Application for Delivery of Hydrophobic Drugs [J]. Chem. J. Chinese Universities, 2008, 29(5): 1021.
[15]	HU Wan-Qun, XU Yu, LIU Fei, RUI Lei, GUO Qing-Xiang. Determination of Azithromycin in Human Plasma by High Performance Liquid Chromatography Coupled with Tandem Mass Spectrometry [J]. Chem. J. Chinese Universities, 2007, 28(11): 2046.