Conservative and Variability of the Important Functional Sites in a Laccase from Bacillus Subtilis†

doi:10.7503/cjcu20160092

Abstract

Abstract:

A laccase from Bacillus subtilis has more than 96% residue identity to most other bacterial laccases, but has lower catalytic activity. Four mutant laccases were designed and their catalytic properties and functions were investigated. The results demonstrated that residue H155 was particularly essential for the catalytic activity of this laccase, and was one of the key residues in the second conserved region of laccases. Replacement of this residue reduced the oxidation-reduction potential and the catalytic activity of the laccase, and also reduces its thermal or pH stability, and caused a shift of its optimum pH from 5.0 to 4.0. Conservation of residues A158 and I224 in non-conserved region of the laccase was also advantageous for the catalysis of the laccase. A158 was conducive to the electron transport in enzymatic oxidation process, while I224 was appropriate to make the substrate into the mononuclear center of the laccase. S210G mutation enhanced the catalytic efficiency of the laccase perhaps by increasing of the flexibility of the pro-rich loop adjacent to the entrance of the substrate channel of this laccase. The laccase in this study decolorized indigo dyes such as indigo carmine more effectively than triphenylmethane dyes such as crystal violet, azo dyes such as methyl red or Congo red, and anthraquinone dyes such as Remazol Brilliant Blue R(RBBR), indicated that the laccase in this study had certain substrate selectivity. These results would provide some insights into the relationship between the structure and function of bacterial laccases.

Key words: Laccase, Structure, Catalysis, Baculus subtilis

CLC Number:

O625.75
Q554

TrendMD:

JIAO Jing, YANG Xue, JIN Lanna, GAO Jian, ZHOU Yang, XIAO Yazhong, ZHANG Yingjiu. Conservative and Variability of the Important Functional Sites in a Laccase from Bacillus Subtilis^†[J]. Chem. J. Chinese Universities, 2016, 37(7): 1320.

Figures/Tables 9

Fig.1 3D structure of laccase CARFig.1(B) is an enlarged view of the white box in Fig.1(A). Balls: copper ions; solid arrows: the entrance of substrates; dashed arrows: electron transfer from the mononuclear centre to the trinuclear centre of CAR; orange peptide fragment: pro-rich peptide fragment.

Table 1 Designed primers

Primer	Sequence(5'→3')	Primer	Sequence(5'→3')
CAHS	CGATCACGCCATGGCGCTC	CAHEGS	TTATCCGGGCGCACCGGAA
CAHA	CCATGGCGTGATCGTGATACCAC	CAHEGA	TTCCGGTGCGCCCGGATAA
CAHES	TCACGCCATGGAGCTC	CAHEGFS	AATCCTTCATTCGTTC
CAHEA	TGAGCTCCATGGCGTGATC	CAHEGFA	GAACGAATGAAGGATT

Table 2 Final concentration and maximum absorbance wavelengths of the tested dyes

Dye	M_w/Da	c/(mg·L^-1)	λ_max/nm
Indigo carmine	466.37	40	610
Crystal violet	407.98	5	590
Gongo red	696.67	10	595
Methyl red	269.30	50	410
Remazol brilliant blue R(RBBR)	626.54	100	591

Fig.2 SDS-PAGE analysis of the purified laccases Lane M: protein markers; lanes 1—3: purified laccase CAHEG,CAH and CAHEGF; lanes 4 and 5: purified laccase CAHE.

Table 3 Specific activities and oxidation-reduction potentials of the wild type and mutant laccases

Enzyme	Specific activity/ (U·mg^-1)	Oxidation-reduction potential/V	Enzyme	Specific activity/ (U·mg^-1)	Oxidation-reduction potential/V
CAR	17.1	0.320	CAHEG	99.0	0.395
CAH	220.4	0.420	CAHEGF	67.7	0.345
CAHE	70.2	0.385

Table 4 Kinetic parameters of the wild type and mutant laccases

Enzyme	K_m/(mmol·L^-1)	k_cat/s^-1	k_cat· $K m - 1$ /(L·s^-1·mmol^-1)
CAR	0.17	26.0	153.0
CAHE	0.13	34.0	263.0
CAHEGF	0.14	34.0	243.0
CAHEG	0.12	35.0	292.0
CAH	0.10	85.0	850.0

Table 4 Kinetic parameters of the wild type and mutant laccases

Enzyme	K_m/(mmol·L^-1)	k_cat/s^-1	k_cat· $K m - 1$ /(L·s^-1·mmol^-1)
CAR	0.17	26.0	153.0
CAHE	0.13	34.0	263.0
CAHEGF	0.14	34.0	243.0
CAHEG	0.12	35.0	292.0
CAH	0.10	85.0	850.0

Fig.3 Thermostabilities(A) and acid-base stabilities(B) of the wild type and mutant laccases

Fig.4 Decolorization of several dyes by the wild type and mutant laccases(A) CAH; (B) CAHEG; (C) CAHEGF; (D) CAR. ● Indigo carmine; □ crystal violet; △ gongo red; ▲ methyl red; ○ RBBR.

Fig.5 3D structures and the active sites of wild type and mutant laccases Ball: copper ions; P: Pro residue; arrow: entrance of substrate.

References 26

[1]	Gao J., Guan K. X., Jiao J., Jiang W. Z., Zhang Y. J., Journal of Molecular Catalysis,2014, 28(2), 188—196(高键, 关可兴, 焦晶, 姜文洙, 张应玖. 分子催化, 2014, 28(2), 188—196)
[2]	Giardina P., Sannia G., Cell Mol. Life Sci. J., 2015, 72(5), 855—856
[3]	Shraddha, Shekher R., Sehgal S., Kamthania M., Kumar A.,Enzyme Res., 2011, 217861
[4]	Moccelini S. K., Franzoi A. C., Vieira I. C., Dupont J., Scheeren C. W., Biosens. Bioelectron., 2011, 26(8), 3549—3554
[5]	Guan Z. B., Shui Y., Song C. M., Zhang N., Cai Y. J., Liao X. R., Environ. Sci. Pollut. Res. Int., 2015, 22(12), 9515—9523
[6]	Chandra R., Chowdhary P., Environ. Sci. Processes Impacts., 2015, 17(2), 326—342
[7]	Virk A. P., Sharma P., Capalash N., Biotechnology Prog., 2012, 28(1), 21—32
[8]	Osma J.F., Toca-Herrera J. L., Rodríguez-Couto S.,Enzyme Res., 2010, 918761
[9]	Abdel-Hamid A. M., Solbiati J. O., Cann I. K., Adv. Appl. Microbiol., 2013, 82, 1—28
[10]	Pollegioni L., Tonin F., Rosini E., FEBS J. Lignin-degrading Enzymes,2015, 282(7), 1190—1213
[11]	Wang J., Feng J., Jia W., Chang S., Li S., Li Y., Biotechnol. Biofuels,2015, 8, 145
[12]	Roth S., Spiess A. C., Bioprocess Biosyst. Eng., 2015, 38(12), 2285—2313
[13]	Reiss R., Ihssen J., Thöny-Meyer L., BMC Biotechnol., 2011, 11, 9
[14]	Mollania N., Khajeh K., Ranjbar B., Enzyme Microb. Technol., 2013, 52(6/7), 325—330
[15]	Mohammadian M., Fathi-Roudsari M., Mollania N., J. Ind. Microbiology Biotechnol. J., 2010, 37(8), 863—869
[16]	Pezzella C., Guarino L., Piscitelli A., Cell Mol. Life Sci., 2015, 72(5), 923—940
[17]	Kudanga T., le Roes-Hill M., Appl. Microbiol. Biotechnol., 2014, 98(15), 6525—6542
[18]	Sitarz A. K., Mikkelsen J. D., Meyer A. S., Crit. Rev. Biotechnol., 2016, 36(1), 70—86
[19]	Gündüz Ergün B., Çalık P., Bioprocess Biosyst. Eng., 2015, 39(1), 1—36
[20]	Hakulinen N., Rouvinen J., Cell Mol. Life Sci., 2015, 72(5), 857—868
[21]	Mate D. M., Alcalde M., Biotechnol. Adv., 2015, 33(1), 25—40
[22]	Jia H., Lee F. S., Farinas E. T., ACS Comb. Sci., 2014, 16(12), 665—669
[23]	Gupta N., Farinas E. T., Protein Eng. Des. Sel., 2010, 23(8), 679—682
[24]	Xia Y., Cao H., Zhang Y. J., Chem. J. Chinese Universities,2015, 36(2), 330—335(夏莹, 曹昊, 张应玖. 高等学校化学学报, 2015, 36(2), 330—335)
[25]	Bourbonnais R., Paice M. G., FEBS Lett., 1990, 267(1), 99—102
[26]	Enguita F. J., Martins L. O., Henriques A. O., Carrondo M. A., J. Biol. Chem., 2003, 278(21), 19416—19425