Programming Single Quantum Dot Valencies via DNA Caging†

doi:10.7503/cjcu20170539

Abstract

Abstract:

A fundamental unsolved problem for quantum dot(QD) chemistry is to simultaneously control the type, number and spatial orientation of QD valencies(i.e., the binding sites on each QD). Herein, we demonstrate a strategy to generate structurally predicable multivalent QD with uniform valency type, number and spatial orientation by caging the QD in a DNA cube by DNA nanotechnology. The results show that diffe-rent DNA valencies could be anchored to specific positions of the cube to form homogeneous DNA-functiona-lized QD with adjacent or diagonal valencies. As a proof-of-concept study, different sizes of gold nanoparticles(GNPs) were conjugated to each QD valency through DNA hybridization. The resulting bivalent and trivalent QD conjugates not only possess the same GNP number but also uniform assembly geometry by low magnification and high-resolution TEM. This approach holds great potential for generating multivalent and multifunc-tional QD probes for advanced biological applications.

Key words: DNA, Quantum dot, Functionalization, Gold nanoparticles

CLC Number:

O657

TrendMD:

WANG Li, LI Zhi, SHEN Xiaoqin, MA Nan. Programming Single Quantum Dot Valencies via DNA Caging^†[J]. Chem. J. Chinese Universities, 2018, 39(1): 32.

Figures/Tables 12

Table 1 DNA sequences

Name	DNA sequence(5'-3')
DNA1	TCGCTGAGTAATCGTAACTCGCCTACTGGTCAGCAAGTGTGGGCACGCACACAGTAGTAATACCAGAT-GGAGTACACAAATCTG
DNA2	CTATCGGTAGAGCAGCTATGGATCCGACGTTATACTCAGCGACAGATTTGTGAGATGACCTCTGATTA-CGCGTACAACTAGCGG
DNA3	CACTGGTCAGATACAGAATCACTGGAACAGTACTACCGATAGCCGCTAGTTGAGATGCCTAAGTA-GCGCCATGAGGTTTGCTGA
DNA4	CCACACTTGCAAGTCCTAGACGGTAGCTCGAACTGACCAGTGTCAGCAAACCAGACTA-TCGATGGCATAATCCAGTGTGCGTGC
DNA5	GTACGCGTCTAGGATCAAAAAGTTCCAGTGATTCTGTA
DNA6	TCGAGCTACCGTCTAGGACT
DNA7	GACCAGTAGGCGAGTTACGA
DNA8	AACGTCGGATCCATAGCTGC
DNA9	GGATTATGCCATCGATAGTC
DNA10	CATGGCGCTACTTAGGCATC
DNA11	ACGCGTAATCAGAGGTCATC
DNA12	ACTCCATCTGGTATTACTACAAAAAAAAAAAA
DNA13(ps-po DNA)	GATCCTAGACGCGTACAAAAAG^G^G^G^G^G^G^G^G^G^TTTTTTTTTTTT
DNA14(thiolated)	CATTGATCCGAGCCTAAAAAAAAAA
DNA15(thiolated)	TGATTCCAGGTAGCAAAAAAAAAAA
DNA16(thiolated)	CGTGCTAAGTGCGATAAAAAAAAAA
DNA6'	TGCTACCTGGAATCATCGAGCTACCGTCTAGGACT
DNA7'	AGGCTCGGATCAATGGACCAGTAGGCGAGTTACGA
DNA11'	ATCGCACTTAGCACGACGCGTAATCAGAGGTCATC
DNA12'(Cy-5)	ACTCCATCTGGTATTACTACAAAAAAAAAAAA-Cy5

Scheme 1 Design of DNA cube(A), DNA cube-QDs and QDs-GNPs(B)

Table 2 Reactant volumes of gold nanoparticles with different sizes

Size/nm	V(H₂O)/mL	V(HAuCl₄)/μL	V(Citrate acid)/mL
15	25	250	1.25
20	30	300	1.05

Fig.1 5% Native PAGE characterization of DNA cubeThe expected hybridization product of each sample is illustrated above.

Fig.2 AFM image(A) and height statistics(B) of DNA cube

Fig.3 Absorption(a) and photoluminescence(b) spectra of DNA13-QD(A), native PAGE characterization of hybridization between DNA13-QD(lane 1) and DNA5(lane 2)(B) and low(C) and high-resolution(D) TEM images of DNA13-QD

Scheme 2 Schematic illustration of the assembly route of the DNA-caged QD The complementary ssDNA domains are highlighted in same colors.

Fig.4 Native PAGE characterization of heterobivalent QD(lane 1), DNA cube-QD(lane 2), and DNA cube(lane 3), low magnification(B1) and high-resolution(B2) TEM images of DNA cube-QD stained with phosphotungstic acid and AFM image(C) and height statistics(D) of DNA cube-QDThe DNA cube was pre-stained with GelRed before loading on the gel.

Fig.5 Fluorescence spectra of DNA cube-QD(a), DNA cube-QD with Cy5 labeling(b) and empty DNA cube with Cy5 labeling(c)(A) and QD-Cy5(a), QD(b), QD-Cy5+cDNA(c)(B)All samples were excited at 405 nm.

Fig.6 Schematic illustration of DNA-caged QD with adjacent(1 and 2) and diagonal(2 and 3) valencies(A), low and high magnification TEM images of GNPs assembled to bivalent DNA-caged QD with adjacent valencies(B) and diagonal valencies(C)

Fig.7 Statistics of the separation distance(center to center, inset) of GNPs conjugated to bivalent QDs with adjacent(A) and diagonal valencies(B)50 complex structures were examined in each case.

Fig.8 Assembly of different sized GNPs with DNA-caged QDs(A) Low and high magnification TEM images of small and large GNPs assembled to bivalent DNA-caged QD with adjacent position; (B) low and high magnification TEM images of small, medium and large GNPs assembled to trivalent DNA-caged QD with adjacent and diagonal position.

References 28

[1]	Michalet X., Pinaud F. F., Bentolila L. A., Tsay J. M., Doose S., Li J. J., Sundaresan G., Wu A. M., Gambhir S. S., Weiss S., Science, 2005, 307(5709), 538—544
[2]	Medintz I. L., Uyeda H. T., Goldman E. R., Mattoussi H., Nat. Mater., 2005, 4(6), 435—446
[3]	Bruchez M. J., Moronne M., Gin P., Weiss S., Alivisatos A. P., Science, 1998, 281(5385), 2013—2016
[4]	Gao X., Cui Y., Levenson R. M., Chung L. W., Nie S., Nat. Biotechnol., 2004, 22(8), 969—976
[5]	Liu W., Howarth M., Greytak A. B., Zheng Y., Nocera D. G., Ting A. Y., Bawendi M. G., J. Am. Chem. Soc., 2008, 130(4), 1274—1284
[6]	Yu J. H., Kwon S. H., Petrášek Z., Park O. K., Jun S. W., Shin K., Choi M., Park Y. I., Park K., Na H. B., Lee N., Lee D. W., Kim J. H., Schwille P., Hyeon T., Nat. Mater., 2013, 12(4), 359—366
[7]	Biju V., Itoh T., Ishikawa M., Chem. Soc. Rev., 2010, 39(8), 3031—3056
[8]	Pons T., Medintz I. L., Wang X., English D. S., Mattoussi H., J. Am. Chem. Soc., 2006, 128(47), 15324—15331
[9]	Lee H., Lytton-Jean A. K., Chen Y., Love K. T., Park A. I., Karagiannis E. D., Sehgal A., Querbes W., Zurenko C. S., Jayaraman M., Peng C. G., Charisse K., Borodovsky A., Manoharan M., Donahoe J., Truelove J., Nahrendorf M., Langer R., Anderson D. G., Nat. Nanotechnol., 2012, 7(6), 389—393
[10]	Mirkin C. A., Letsinger R. L., Mucic R. C., Storhoff J. J., Nature, 1996, 382(6592), 607—609
[11]	Le J. D., Pinto Y., Seeman N. C., Musier-Forsyth K., Taton T. A., Kiehl R. A., Nano Lett., 2004, 4(12), 2343—2347
[12]	Deng Z. X., Tian Y., Lee S. H., Ribbe A. E., Mao C. D., Angew. Chem. Int. Ed., 2005, 44(23), 3582—3585
[13]	Cheglakov Z., Weizmann Y., Braunschweig A. B., Wilner O. I., Willner I., Angew. Chem. Int. Ed., 2008, 47(1), 126—130
[14]	Wilner O. I., Shimron S., Weizmann Y., Wang Z. G., Willner I., Nano Lett., 2009, 9(5), 2040—2043
[15]	Edwardson T. G., Carneiro K. M., McLaughlin C. K., Serpell C. J., Sleiman H. F., Nat. Chem., 2013, 5(10), 868—875
[16]	Zhang C., Li X., Tian C., Yu G., Li Y., Jiang W., Mao C. D., ACS Nano, 2014, 8(2), 1130—135
[17]	Yan H., Park S. H., Finkelstein G., Reif J. H., LaBean T. H., Science, 2003, 301(5641), 1882—1884
[18]	Ma X., Huh J., Park W., Lee L.P., Kwon Y. J., Sim S. J.,Nat. Comm., DOI: 10.1038/ncomms12873
[19]	Zanchet D., Micheel C. M., Parak W. J., Gerion D., Alivisatos A. P., Nano Lett., 2001, 1(1), 32—35
[20]	Ackerson C. J., Sykes M. T., Kornberg R. D., Proc. Natl. Acad. Sci. USA, 2005, 102(38), 13383—13385
[21]	Borovok N., Gillon E., Kotlyar A., Bioconjug. Chem., 2012, 23(5), 916—922
[22]	Ma N., Sargent E. H., Kelley S. O., Nat. Nanotechnol., 2009, 4(2), 121—125
[23]	Tikhomirov G., Hoogland S., Lee P. E., Fischer A., Sargent E. H., Kelley S. O., Nat. Nanotechnol., 2011, 6(8), 485—490
[24]	He X. W., Li Z., Chen M. Z., Ma N., Angew. Chem. Int. Ed., 2014, 53(52), 14447—14450
[25]	He X. W., Zeng T., Li Z., Wang G. L., Ma N., Angew. Chem. Int. Ed., 2016, 55(9), 3073—3076
[26]	Yu W., Lian H., Wen Z., Xiao G., Chem. Mater., 2003, 15(14), 2854—2860
[27]	Aldeek F., Safi M., Zhan N., Palui G., Mattoussi H., ACS Nano, 2013, 7(11), 10197—10210
[28]	Claridge S. A., Goh S. L., Frechet J. M., Williams S. C., Micheel C. M., Alivisatsos A. P., Chem. Mater., 2005, 17(7), 1638—1635