Chem. J. Chinese Universities ›› 2017, Vol. 38 ›› Issue (10): 1897.doi: 10.7503/cjcu20170121
• Polymer Chemistry • Previous Articles Next Articles
QIU Linzi1, WANG Guirong1, PAN Yan2, WANG Yiwen3, LI Xinqing4, DENG Linhong2, Mark Bradley5, ZHANG Rong1,*(
)
Received:2017-02-27
Online:2017-10-10
Published:2017-09-07
Contact:
ZHANG Rong
E-mail:rzhang@cczu.edu.cn
Supported by:CLC Number:
TrendMD:
QIU Linzi, WANG Guirong, PAN Yan, WANG Yiwen, LI Xinqing, DENG Linhong, Mark Bradley, ZHANG Rong. Polymer Coatings for Purification and Long-term Culture of Human Adipose-derived Stem Cells†[J]. Chem. J. Chinese Universities, 2017, 38(10): 1897.
| Polymer coating | Component | m(DMC):m(CHMA):m(DEAEMA) |
|---|---|---|
| PC1 | Poly(DMC-co-CHMA-co-DEAEMA) | 1:1:1 |
| PC2 | Poly(DMC-co-CHMA-co-DEAEMA) | 3:1:2 |
| PC3 | Poly(DMC-co-CHMA-co-DMAEMA) | 3:1:2 |
Table 1 Mass ratio of monomers used for the preparation of PC
| Polymer coating | Component | m(DMC):m(CHMA):m(DEAEMA) |
|---|---|---|
| PC1 | Poly(DMC-co-CHMA-co-DEAEMA) | 1:1:1 |
| PC2 | Poly(DMC-co-CHMA-co-DEAEMA) | 3:1:2 |
| PC3 | Poly(DMC-co-CHMA-co-DMAEMA) | 3:1:2 |
| Polymer coating | Γ/(mN·m-1) | γd/(mN·m-1) | γp/(mN·m-1) |
|---|---|---|---|
| PC1 | 33.5 | 12.9 | 20.6 |
| PC2 | 34.7 | 11.3 | 23.4 |
| PC3 | 36.1 | 11.2 | 24.9 |
Table 2 Surface free energy of PC
| Polymer coating | Γ/(mN·m-1) | γd/(mN·m-1) | γp/(mN·m-1) |
|---|---|---|---|
| PC1 | 33.5 | 12.9 | 20.6 |
| PC2 | 34.7 | 11.3 | 23.4 |
| PC3 | 36.1 | 11.2 | 24.9 |
| Element | PC1 | PC2 | PC3 | |||
|---|---|---|---|---|---|---|
| Experimental | Theoretical | Experimental | Theoretical | Experimental | Theoretical | |
| C1s | 68.2 | 63.8 | 70.6 | 63.6 | 50.0 | 59.9 |
| N1s | 4.5 | 4.8 | 5.0 | 4.6 | 6.9 | 4.8 |
| O1s | 18.3 | 17.5 | 15.6 | 16.9 | 33.5 | 17.4 |
| C | 0.8 | 5.7 | 1.1 | 8.5 | 1.8 | 8.5 |
Table 3 Elemental compositions(%) of PC based on XPS analysis
| Element | PC1 | PC2 | PC3 | |||
|---|---|---|---|---|---|---|
| Experimental | Theoretical | Experimental | Theoretical | Experimental | Theoretical | |
| C1s | 68.2 | 63.8 | 70.6 | 63.6 | 50.0 | 59.9 |
| N1s | 4.5 | 4.8 | 5.0 | 4.6 | 6.9 | 4.8 |
| O1s | 18.3 | 17.5 | 15.6 | 16.9 | 33.5 | 17.4 |
| C | 0.8 | 5.7 | 1.1 | 8.5 | 1.8 | 8.5 |
Fig.6 Fluorescence images of hASC cultured on the surface of PC2 for 1 d(A, A'), 4 d(B, B') and 7 d(C, C'), respectively(A—C) DAPI(λEx/λEm 358 nm/461 nm)stained nuclei of hASC;(A'—C') calcein-AM(λEx/λEm 490 nm/515 nm)stained hASC.
| Polymer coating | CD105 | CD49d | ||||
|---|---|---|---|---|---|---|
| p0 | p1 | p3 | p0 | p1 | p3 | |
| TCP | 42.04 | 75.42 | 87.91 | 37.91 | 71.79 | 77.23 |
| PC1 | 67.18 | 93.44 | 59.09 | 69.38 | ||
| PC2 | 89.90 | 97.11 | 61.40 | 85.09 | ||
| PC3 | 54.57 | 95.51 | 31.91 | 80.18 | ||
Table 4 Expression of CD105 and Cd49d of hASC cultured on PC and TCP
| Polymer coating | CD105 | CD49d | ||||
|---|---|---|---|---|---|---|
| p0 | p1 | p3 | p0 | p1 | p3 | |
| TCP | 42.04 | 75.42 | 87.91 | 37.91 | 71.79 | 77.23 |
| PC1 | 67.18 | 93.44 | 59.09 | 69.38 | ||
| PC2 | 89.90 | 97.11 | 61.40 | 85.09 | ||
| PC3 | 54.57 | 95.51 | 31.91 | 80.18 | ||
Fig.8 Images of adipogenic(A1—D1), osteogenic(A2—D2) and chondrogenic(A3—D3) differentiation of hASC cultured on PC1(A1—A3), PC2(B1—B3), PC3(C1—C3) and TCP(D1—D3) respectivelyAdipocytes were stained with Oil Red O, Osteocytes with Alizarin Red S and Chondrocytes with Alcian Blue.
Fig.9 Relative gene expression of adipogenic, osteogenic and chondrogenic differentiation of hASC cultured on PC2 and TCP*Denotes a statistical significance of P<0.05, compared to data obtained on TCP.
| Gene name | Primer sequence(5' to 3') | Length(bp) | Tm/℃ |
|---|---|---|---|
| PPARγ2 | CAGGCTCCACTTTGATTGC | 19 | 57.6 |
| PPARγ2 | TCTCCAGCATTTCTACTACACA | 22 | 58.2 |
| ALP | CCACTGACTTCCCTGCCTTC | 20 | 59.8 |
| ALP | GGGCAACTTCCAGACCATT | 19 | 57.6 |
| SOX9 | TGGTGGTCGGTGTGATCGTA | 20 | 59.8 |
| SOX9 | CGAACGCACATCAAGACG | 18 | 57.3 |
Table 5 Primers information used in RT-qPCR
| Gene name | Primer sequence(5' to 3') | Length(bp) | Tm/℃ |
|---|---|---|---|
| PPARγ2 | CAGGCTCCACTTTGATTGC | 19 | 57.6 |
| PPARγ2 | TCTCCAGCATTTCTACTACACA | 22 | 58.2 |
| ALP | CCACTGACTTCCCTGCCTTC | 20 | 59.8 |
| ALP | GGGCAACTTCCAGACCATT | 19 | 57.6 |
| SOX9 | TGGTGGTCGGTGTGATCGTA | 20 | 59.8 |
| SOX9 | CGAACGCACATCAAGACG | 18 | 57.3 |
| [1] | Duffy C. R., Zhang R., How S. E., Biomaterials,2014, 35(23), 5998—6005 |
| [2] | Mauney J. R., Kaplan D. L., Volloch V., Biomaterials,2004, 25(16), 3233—3243 |
| [3] | Mauney J. R., Volloch V., Kaplan D. L., Biomaterials,2005, 26(31), 6167—6175 |
| [4] | Duffy C. R. E., Zhang R., How S. E., Biomater. Sci., 2014, 2(11), 1683—1692 |
| [5] | Kim M. R., Jeong J. H., Park T. G., Biotechnol. Progr., 2002, 18(3), 495—500 |
| [6] | Stile R. A., Healy K. E., Biomacromolecules,2001, 2(1), 185—194 |
| [7] | Haraguchi K. T. T., Ebato M., Biomacromolecules,2006, 7, 3267—3275 |
| [8] | Mant A., Tourniaire G., Diaz-Mochon J. J., Biomaterials,2006, 27(30), 5299—5306 |
| [9] | Anderson D. G., Levenberg S., Langer R., Nat. Biotechnol., 2004, 22(7), 863—866 |
| [10] | Fisher J. P., Dean D., Engel P. S., Annu. Rev. Mater. Res., 2001, 31(1), 171—181 |
| [11] | Burkoth A. K., Burdick J., Anseth K. S., J. Biomd. Mater. Res., 2000, 51(3), 352—359 |
| [12] | Benoit D. S. W., Schwartz M. P., Durney A. R., Nat. Mater., 2008, 7(10), 816—823 |
| [13] | Luo Y., Shoichet M. S., Nat. Mater., 2004, 3(4), 249—253 |
| [14] | Tibbitt M. W., Anseth K. S., Biotechnol. Bioeng., 2009, 103(4), 655—663 |
| [15] | Mann B. K., Biomaterials, 2001, 22(22), 3045—3051 |
| [16] | Zuk P. A., Zhu M., Ashjian P., Mol. Microbiol., 2002, 13(12), 4279—4295 |
| [17] | Zuk P. A., Zhu M., Mizuno H., Tissue Eng., 2001, 7(2), 211—228 |
| [18] | Zhang R., Liberski A., Sanchez-Martin R., Biomaterials,2009, 30(31), 6193—6201 |
| [19] | López-Pérez P. M., Marques A. P., J. Mater. Chem., 2007, 17(38), 4064—4071 |
| [20] | Feng X. J., Shi Y. L., Yang W., Chemistry,2014, 77(5), 418—424 |
| [21] | Kurkuri M. D., Driever C., Thissen H., Biomacromolecules,2009, 10(5), 1163—1172 |
| [22] | Liu X., Feng Q., Bachhuka A., ACS Appl. Mater. Interfaces,2014, 6(12), 9733—9741 |
| [23] | Yao X., Peng R., Ding J., Adv. Mater., 2013, 25(37), 5257—5286 |
| [24] | Balloni S., Calvi E. M., Damiani F., Int. J. Oral Maxillofac. Implants,2009, 24(4) |
| [25] | De Ugarte D. A., Morizono K., Elbarbary A., Cells Tissues Organs, 2003, 174(3), 101—109 |
| [26] | Moriguchi T., Yano K., Nakagawa S., J. Colloid Interface Sci., 2003, 260(1), 19—25 |
| [27] | Paul H., Reginato A. J., Ralph S. H., Arthritis Rheumatism, 1983, 26(2), 191—200 |
| [1] | WANG Dagui, CHEN Yajie, JIAN Qi, GAO Pengcheng, XIA Fan. Research Advance of Polymer Anti-fouling Coatings [J]. Chem. J. Chinese Universities, 2020, 41(12): 2638. |
| [2] | WANG Xinghuo,TANG Jun,YANG Yingwei. Mesoporous Silica Nanoparticles-Based Stimuli-Responsive Drug Delivery Systems Gated by Polymers † [J]. Chem. J. Chinese Universities, 2020, 41(1): 28. |
| [3] | FENG Wenya, QIAO Juan, QI Li, LI Zhiwei. Sepatation of Antipyretic Analgesics by CapillaryElectrochromatography with Block Copolymer Coating† [J]. Chem. J. Chinese Universities, 2018, 39(8): 1640. |
| [4] | CAO Yuhui, ZHANG Juanjuan, WANG Zaiyang, ZHAO Yuanhui. Separation and Identification of Oyster Peptide Modified by Plastein Reaction and Characterization of Peptide-zinc Complexes† [J]. Chem. J. Chinese Universities, 2018, 39(3): 470. |
| [5] | LIU Lei, LI Ke, HAO Xia, WANG Guizhen, QIN Xuemei, DU Guanhua, ZHANG Xiang. Extraction, Separation, Structural Analysis and Antioxidant Activity in vitro of Arabinoxylans(AX-Ⅰ-1) from the Residue of Astragalus Root† [J]. Chem. J. Chinese Universities, 2016, 37(12): 2168. |
| [6] | ZHU Jinming, SUN Zhuo, FU Yao, GUO Yi, XU Li. Labeling and Purification of Alcalase and Fluorescent Nanocrystals Synthesized in Water Phase† [J]. Chem. J. Chinese Universities, 2015, 36(3): 511. |
| [7] | SONG Panshu, WANG Jun, REN Tongxiang, ZHOU Tao, LU Hai. Novel Purification Method for Isotopically Enriched Molybdenum and Determination of Its Mass Fractionation Effect† [J]. Chem. J. Chinese Universities, 2015, 36(2): 248. |
| [8] | ZENG Qinghui, LI Na, TIAN Ye, WU Di, ZHAO Yaowu, LI Lihua, ZHOU Changren. Effects of Collagen Films with Liquid Crystal-liked Ordered Structure on Adhesion, Proliferation and Differentiation of Human Umbilical Cord Mesenchymal Stem Cells† [J]. Chem. J. Chinese Universities, 2014, 35(8): 1658. |
| [9] | SHEN Qingqing, ZENG Mingyong, ZHAO Yuanhui. Modification of Acaudina Molpadioides Hydrolysates by Plastein Reaction and Preparation of ACE Inhibitory Peptides† [J]. Chem. J. Chinese Universities, 2014, 35(5): 965. |
| [10] | WANG Hai-Tao, WANG Wei, CHEN Ming, YUAN Ning, ZHAO Yuan-Hui, MAO Xiang-Zhao. Active Peptide from Acetes Chinensis with Inhibitory Activity on Neuraminidase of Influenza Virus [J]. Chem. J. Chinese Universities, 2013, 34(11): 2540. |
| [11] | CHEN Ning, SUN Yi, LIU Shu-Ying. Preparation and Antioxidant Activities of Walnut Protein Hydrolysates [J]. Chem. J. Chinese Universities, 2013, 34(1): 72. |
| [12] | ZHAO Yuan-Hui, LI Ba-Fang, MA Jing-Jun, DONG Shi-Yuan, LIU Zun-Ying, ZENG Ming-Yong. Purification and Synthesis of ACE Inhibitory Peptide from Acaudina molpadioidea Protein Hydrolysate [J]. Chem. J. Chinese Universities, 2012, 33(02): 308. |
| [13] | WANG Wen-Jia, GUO Xiao-Lin, WEI An-Hui, FU Chang-Hao, HAN Zhen-Guo. Purification of Histidine-tagged Fusion Proteins Based on Fe3O4@SiO2/Ni-NTA Magnetic Spheres [J]. Chem. J. Chinese Universities, 2012, 33(02): 303. |
| [14] | ZHANG Xiao1,2, LIAN Gang1*, TAN Miao1, ZHANG Shun-Jie1,2, CUI De-Liang1*, WANG Qi-Long2. Self-aggregation Inducing High-ratio cBN Microcrystals Growth in Hydrothermal Solution [J]. Chem. J. Chinese Universities, 2011, 32(3): 655. |
| [15] | WU Le-Qin, ZHANG Jing*, SUN Run-Guang, JIANG Shao-Fen, WANG Yan-Li, DAI Jing-Jing. Isolation and Structure Characterization of Polysaccharide from Atractylodes Macrocephala Koidz [J]. Chem. J. Chinese Universities, 2011, 32(12): 2812. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||