Polymer Coatings for Purification and Long-term Culture of Human Adipose-derived Stem Cells†

doi:10.7503/cjcu20170121

Abstract

Abstract:

Polymer coating(PC) based on polyacrylate hydrogels was prepared through UV initiated polymerization and characterized with X-ray photoelectron spectroscopy(XPS), water contact angles(WCA) and atomic force microscopy(AFM) respectively to understand their chemistry and surface properties. The biological characteristics of human adipose-derived stem cell(hASC) were evaluated after long-term cultured on PC in vitro for 3 passages. The results indicated that the hASC proliferated successfully on the PC, expressed high percentage of specific membrane markers CD49d, CD73, CD105, and very low percentage of HLA-DR and CD31 by using flow cytometry. The results suggested that the proliferated stem cells had the characteristics of hASC. The hASC were differentiated to adipocytes, osteoblasts and chondrocytes and stained with Oil Red O, Alizarin Red S and Alcian Blue respectively to demonstrate the maintaining of pluripotency of hASC. The results showed that the PC2 based on methacrylatoethyltrimethyl ammonium chloride, cyclohexyl methacrylate and diethyl amino ethyl methacrylate(mass ratio of 3:1:2) was the best in hASC binding and proliferation, improved the purification, maintained the pluripotency among the three coatings and TCP. Relative gene expression of the differentiated cells was analyzed by quantitative real-time polymerase chain reaction(RT-qPCR). The results show that the harvest hASC from PC2 are apt to differentiate to osteoblasts and chondrocytes.

Key words: Polymer coating, Human adipose-derived stem cell, Long-term culture in vitro, Purification, Differentiation, Polyacrylate hydrogel

CLC Number:

O632

TrendMD:

QIU Linzi, WANG Guirong, PAN Yan, WANG Yiwen, LI Xinqing, DENG Linhong, Mark Bradley, ZHANG Rong. Polymer Coatings for Purification and Long-term Culture of Human Adipose-derived Stem Cells^†[J]. Chem. J. Chinese Universities, 2017, 38(10): 1897.

Figures/Tables 14

Table 1 Mass ratio of monomers used for the preparation of PC

Polymer coating	Component	m(DMC):m(CHMA):m(DEAEMA)
PC1	Poly(DMC-co-CHMA-co-DEAEMA)	1:1:1
PC2	Poly(DMC-co-CHMA-co-DEAEMA)	3:1:2
PC3	Poly(DMC-co-CHMA-co-DMAEMA)	3:1:2

Table 2 Surface free energy of PC

Polymer coating	Γ/(mN·m^-1)	γ^d/(mN·m^-1)	γ^p/(mN·m^-1)
PC1	33.5	12.9	20.6
PC2	34.7	11.3	23.4
PC3	36.1	11.2	24.9

Fig.1 Water contact angles of PC

Table 3 Elemental compositions(%) of PC based on XPS analysis

Element	PC1		PC2		PC3
Element	Experimental	Theoretical	Experimental	Theoretical	Experimental	Theoretical
C₁_s	68.2	63.8	70.6	63.6	50.0	59.9
N₁_s	4.5	4.8	5.0	4.6	6.9	4.8
O₁_s	18.3	17.5	15.6	16.9	33.5	17.4
C $l 2 p$	0.8	5.7	1.1	8.5	1.8	8.5

Table 3 Elemental compositions(%) of PC based on XPS analysis

Element	PC1		PC2		PC3
Element	Experimental	Theoretical	Experimental	Theoretical	Experimental	Theoretical
C₁_s	68.2	63.8	70.6	63.6	50.0	59.9
N₁_s	4.5	4.8	5.0	4.6	6.9	4.8
O₁_s	18.3	17.5	15.6	16.9	33.5	17.4
C $l 2 p$	0.8	5.7	1.1	8.5	1.8	8.5

Fig.2 XPS spectra of PC(A) Survey spectra; (B—D) high resolution of C1s spectra[PC1(B), PC2(C), PC3(D)].

Fig.3 Representative AFM images of PC1(A), PC2(B) and PC3(C)

Fig.4 Root-mean-square roughness of PC

Fig.5 Average hASC cell numbers per unit area after 1, 4 and 7 d of incubation on PC

Fig.6 Fluorescence images of hASC cultured on the surface of PC2 for 1 d(A, A'), 4 d(B, B') and 7 d(C, C'), respectively(A—C) DAPI(λEx/λEm 358 nm/461 nm)stained nuclei of hASC;(A'—C') calcein-AM(λEx/λEm 490 nm/515 nm)stained hASC.

Fig.7 Expression of surface antigenes before culture and after 3 passages on PC2

Table 4 Expression of CD105 and Cd49d of hASC cultured on PC and TCP

Polymer coating	CD105			CD49d
Polymer coating	p0	p1	p3	p0	p1	p3
TCP	42.04	75.42	87.91	37.91	71.79	77.23
PC1		67.18	93.44		59.09	69.38
PC2		89.90	97.11		61.40	85.09
PC3		54.57	95.51		31.91	80.18

Fig.8 Images of adipogenic(A1—D1), osteogenic(A2—D2) and chondrogenic(A3—D3) differentiation of hASC cultured on PC1(A1—A3), PC2(B1—B3), PC3(C1—C3) and TCP(D1—D3) respectivelyAdipocytes were stained with Oil Red O, Osteocytes with Alizarin Red S and Chondrocytes with Alcian Blue.

Fig.9 Relative gene expression of adipogenic, osteogenic and chondrogenic differentiation of hASC cultured on PC2 and TCP*Denotes a statistical significance of P<0.05, compared to data obtained on TCP.

Table 5 Primers information used in RT-qPCR

Gene name	Primer sequence(5' to 3')	Length(bp)	T_m/℃
PPARγ2	CAGGCTCCACTTTGATTGC	19	57.6
PPARγ2	TCTCCAGCATTTCTACTACACA	22	58.2
ALP	CCACTGACTTCCCTGCCTTC	20	59.8
ALP	GGGCAACTTCCAGACCATT	19	57.6
SOX9	TGGTGGTCGGTGTGATCGTA	20	59.8
SOX9	CGAACGCACATCAAGACG	18	57.3

References 27

[1]	Duffy C. R., Zhang R., How S. E., Biomaterials,2014, 35(23), 5998—6005
[2]	Mauney J. R., Kaplan D. L., Volloch V., Biomaterials,2004, 25(16), 3233—3243
[3]	Mauney J. R., Volloch V., Kaplan D. L., Biomaterials,2005, 26(31), 6167—6175
[4]	Duffy C. R. E., Zhang R., How S. E., Biomater. Sci., 2014, 2(11), 1683—1692
[5]	Kim M. R., Jeong J. H., Park T. G., Biotechnol. Progr., 2002, 18(3), 495—500
[6]	Stile R. A., Healy K. E., Biomacromolecules,2001, 2(1), 185—194
[7]	Haraguchi K. T. T., Ebato M., Biomacromolecules,2006, 7, 3267—3275
[8]	Mant A., Tourniaire G., Diaz-Mochon J. J., Biomaterials,2006, 27(30), 5299—5306
[9]	Anderson D. G., Levenberg S., Langer R., Nat. Biotechnol., 2004, 22(7), 863—866
[10]	Fisher J. P., Dean D., Engel P. S., Annu. Rev. Mater. Res., 2001, 31(1), 171—181
[11]	Burkoth A. K., Burdick J., Anseth K. S., J. Biomd. Mater. Res., 2000, 51(3), 352—359
[12]	Benoit D. S. W., Schwartz M. P., Durney A. R., Nat. Mater., 2008, 7(10), 816—823
[13]	Luo Y., Shoichet M. S., Nat. Mater., 2004, 3(4), 249—253
[14]	Tibbitt M. W., Anseth K. S., Biotechnol. Bioeng., 2009, 103(4), 655—663
[15]	Mann B. K., Biomaterials, 2001, 22(22), 3045—3051
[16]	Zuk P. A., Zhu M., Ashjian P., Mol. Microbiol., 2002, 13(12), 4279—4295
[17]	Zuk P. A., Zhu M., Mizuno H., Tissue Eng., 2001, 7(2), 211—228
[18]	Zhang R., Liberski A., Sanchez-Martin R., Biomaterials,2009, 30(31), 6193—6201
[19]	López-Pérez P. M., Marques A. P., J. Mater. Chem., 2007, 17(38), 4064—4071
[20]	Feng X. J., Shi Y. L., Yang W., Chemistry,2014, 77(5), 418—424
[21]	Kurkuri M. D., Driever C., Thissen H., Biomacromolecules,2009, 10(5), 1163—1172
[22]	Liu X., Feng Q., Bachhuka A., ACS Appl. Mater. Interfaces,2014, 6(12), 9733—9741
[23]	Yao X., Peng R., Ding J., Adv. Mater., 2013, 25(37), 5257—5286
[24]	Balloni S., Calvi E. M., Damiani F., Int. J. Oral Maxillofac. Implants,2009, 24(4)
[25]	De Ugarte D. A., Morizono K., Elbarbary A., Cells Tissues Organs, 2003, 174(3), 101—109
[26]	Moriguchi T., Yano K., Nakagawa S., J. Colloid Interface Sci., 2003, 260(1), 19—25
[27]	Paul H., Reginato A. J., Ralph S. H., Arthritis Rheumatism, 1983, 26(2), 191—200