Retention Behavior of Oligonucleotides under System Containing Mixed Ion-pair Reagents by IP-RPLC†

doi:10.7503/cjcu20180262

Abstract

Abstract:

The retention behaviors of oligonucleotides were investigated under mobile phase containing mixed ion-pair reagents of triethylamine/propylamine-acetate(TEA/PA-AA) and compared with that under classical mobile phase containing triethylamine acetate(TEAA) as ion-pair reagent by ion pair reversed-phase liquid chromatography(IP-RPLC). It is found that the retention of oligonucleotides under TEA/PA-AA system was always weaker than that under TEAA system when the concentration of ion-pair reagents was kept the same. In addition, retention time for most oligonucleotides became longer and longer as the increasing concentration of ion-pair reagents(20—120 mmol/L). As the special case, the retention time of (dC)_n(n>10) was relative stable. The reason should be that the retention of (dC)_n increases fast with the enhanced concentration of ion-pair reagents, and the maximum retention can be achieved under relative low concentration of ion-pair reagents. Additionally, short chain (dT)_n and hetero-oligonucleotides both had better resolution under TEA/PA-AA system than TEAA system. Nevertheless, (dA)_n and (dC)_n both had better resolution under TEAA system. What’s more, the dominated separation mechanism of oligonucleotides under the two systems both were ion-pair model, deduced from the relationship between retention factor k and ion-pair reagents concentration c_p. In general, TEA/PA-AA especially under moderate concentration is superior to TEAA in the separation of hetero-oligonucleotides having same chain length. Ion-pair reagent with low concentration improves the compa-tibility with electrospray ionization-mass spectrometry(ESI-MS), which benefits the qualitative analysis of oligonucleotides.

Key words: Ion pair reversed-phase liquid chromatography(IP-RPLC), Oligonucleotide, Mixed ion-pair reagent, Retention behavior, Retention mechanism

CLC Number:

O657

TrendMD:

QIAO Junqin,LIANG Chao,CAO Zhaoming,LIAN Hongzhen. Retention Behavior of Oligonucleotides under System Containing Mixed Ion-pair Reagents by IP-RPLC^†[J]. Chem. J. Chinese Universities, 2018, 39(9): 1893.

Figures/Tables 15

Table 1 Hetero-oligonucleotides used in the experiment

Oligonucleotide	Sequence(5'-3')	Percentage(%)				ΔG^*/(J·mol^-1)
Oligonucleotide	Sequence(5'-3')	G	C	A	T	ΔG^*/(J·mol^-1)
Oligo20-1	CTTAGTGAAGAGCTCAGTTA	25	15	30	30	-3.97×10⁴
Oligo20-2	CTTAGTGAAGAGTCTCTAAG	25	15	30	30	-2.55×10⁴
Oligo20-3	GACAGGAAAGACATTCTGGC	30	20	35	15	-1.48×10⁴
Oligo20-4	GACAGGAAAGACATTCCGGT	30	20	35	15	-4.08×10⁴
Oligo32-1	GTCGTTATCATCAGAGTAGCCCAGGAAGCTTC	25	25	25	25	-5.60×10⁴
Oligo32-2	GCGTACAGTATAGCCCAGTCTTGAGTGCCATA	25	25	25	25	-1.53×10⁴
Oligo32-3	GGTATGGTTTACGAGTATTGCCTGAAGCGAGG	37.5	12.5	21.9	28.1	-1.95×10⁴
Oligo32-4	CCTCGCTTCAGGCAATACTCGTAAACCATACC	12.5	37.5	28.1	21.9	-1.95×10⁴

Fig.1 Chromatograms of (dA)n under mobile phases containing either 10 mmol/L TEA/10 mmol/L PA(A)or 20 mmol/L TEA(B)Purospher© STAR RP-18 endcapped column(50 mm×4.6 mm i.d., 5 μm); column temperature: 30 ℃; mobile phase A(10 mmol/L TEA/10 mmol/L PA-20 mmol/LAA-5%CH3CN, pH=7.0) or (20 mmol/L TEAA-5%CH3CN, pH=7.0), mobile phase B(10 mmol/L TEA/10 mmol/L PA-20 mmol/L AA-25%CH3CN, pH=7.0) or (20 mmol/L TEAA-25%CH3CN, pH=7.0); gradient elution: 0—40 min, 15%B—45%B; 40—43 min, 45%B—15%B; 43—58 min, 15%B—15%B; flow rate: 1.0 mL/min; detection wavelength: 260 nm.

Fig.2 Retention factor k of (dA)n under mobile phases containing different concentrations of ion-pair reagent(A) TEA/PA; (B) TEA. The concentrations of ion-pair reagent in mobile phase were 20, 40, 60, 80, 100 and 120 mmol/L, respectively. Other chromatographic conditions were the same as in Fig.1.

Table 2 Resolution(Rs) of adjacent peaks in (dA)n under different concentrations of ion-pair reagent

$c * p$ /(mmol·L^-1)	TEA/PA			TEA
$c * p$ /(mmol·L^-1)	A10/A20	A20/A25	A25/A30	A10/A20	A20/A25	A25/A30
20	5.02	1.76	1.34	9.06	2.73	1.97
40	9.20	2.66	1.89	12.47	3.47	2.55
60	10.90	2.96	2.12	13.36	3.74	2.77
80	11.58	3.17	2.29	13.98	3.92	2.89
100	12.37	3.33	2.37	14.76	4.03	2.96
120	12.55	3.34	2.39	14.42	3.99	2.94

Table 2 Resolution(Rs) of adjacent peaks in (dA)n under different concentrations of ion-pair reagent

$c * p$ /(mmol·L^-1)	TEA/PA			TEA
$c * p$ /(mmol·L^-1)	A10/A20	A20/A25	A25/A30	A10/A20	A20/A25	A25/A30
20	5.02	1.76	1.34	9.06	2.73	1.97
40	9.20	2.66	1.89	12.47	3.47	2.55
60	10.90	2.96	2.12	13.36	3.74	2.77
80	11.58	3.17	2.29	13.98	3.92	2.89
100	12.37	3.33	2.37	14.76	4.03	2.96
120	12.55	3.34	2.39	14.42	3.99	2.94

Fig.3 Retention factor k of (dT)n under mobile phases containing different concentrations of ion-pair reagent (A) TEA/PA; (B) TEA. The chromatographic conditions are the same as those in Fig.2.

Table 3 Resolution(Rs) of adjacent peaks in (dT)n under different concentrations of ion-pair reagent

c_p/(mmol·L^-1)	TEA/PA			TEA
c_p/(mmol·L^-1)	T5/T7	T7/T10	T10/T12	T5/T7	T7/T10	T10/T12
20	10.28	9.24	3.78	9.79	9.26	4.08
40	11.79	10.42	4.44	10.96	10.20	4.53
60	12.50	10.96	4.76	11.58	10.48	4.85
80	12.92	11.32	4.85	11.83	10.98	5.06
100	13.32	11.63	5.06	12.24	11.40	5.07
120	13.49	11.78	5.31	12.54	11.60	5.26

Fig.4 Retention factor(k) of (dC)n under mobile phases containing different concentrations of ion-pair reagent (A), (C) TEA/PA; (B), (D) TEA. The chromatographic conditions are the same as those in Fig.2.

Table 4 Resolution(Rs) of adjacent peaks in (dC)n under different concentrations of ion-pair reagent

System	c_p/(mmol·L^-1)	C5/C6	C6/C7	C7/C8	C8/C9	C10/C15	C15/C20	C20/C25
TEA/PA	20	0.43	0.76	1.15	1.53	12.90	5.24	1.88
	40	1.21	1.33	1.38	1.68	12.03	5.44	2.09
	60	1.54	1.58	1.80	2.02	11.46	5.37	2.01
	80	1.67	1.81	1.91	2.12	11.37	5.47	1.93
	100	1.72	1.86	1.94	2.10	11.43	5.09	2.06
	120	1.79	1.95	2.02	2.16	10.94	5.45	2.15
TEA	20	1.16	1.25	1.67	2.00	13.01	5.57	2.00
	40	1.69	1.86	1.98	2.35	13.46	5.53	1.94
	60	1.82	1.98	2.12	2.46	13.05	5.51	1.97
	80	1.91	1.98	2.16	2.41	12.48	5.62	1.99
	100	1.86	1.93	2.07	2.29	12.36	5.31	2.01
	120	1.73	1.90	1.96	2.15	12.04	5.71	2.04

Fig.5 Retention factor(k) of 20mer hetero-oligonucleotides under mobile phases containing different concentrations of ion-pair reagent (A) TEA/PA; (B) TEA. The chromatographic conditions are the same as those in Fig.2.

Table 5 Resolution(Rs) of adjacent peaks in 20mer hetero-oligonucleotides under different concentrations of ion-pair reagent

c_p/(mmol·L^-1)	TEA/PA			TEA
c_p/(mmol·L^-1)	20-4/20-3	20-3/20-2	20-2/20-1	20-4/20-3	20-3/20-2	20-2/20-1
20	2.18	4.41	0.87	1.50	3.90	1.29
40	3.34	6.29	0.61	1.61	5.00	1.32
60	3.73	6.88	0.61	1.88	5.88	1.15
80	4.01	7.59	0.28	2.12	6.65	0.84
100	4.39	8.52^a	0.02^b	2.42	7.29	0.60
120	4.53	8.74^a	0.34^b	2.65	7.84	0.28

Fig.6 Retention factor(k) of 32mer hetero-oligonucleotides under mobile phases containing different concentrations of ion-pair reagent (A) TEA/PA; (B) TEA. The chromatographic conditions a the same as those in Fig.2.

Table 6 Resolution of adjacent peaks in 32mer hetero-oligonucleotides under different concentrations of ion-pair reagent

c_p/(mmol·L^-1)	TEA/PA			TEA
c_p/(mmol·L^-1)	32-1/32-2	32-2/32-3	32-3/32-4	32-1/32-2	32-2/32-3	32-3/32-4
20	0.49	0.02	4.92	0.10^a	0.02^b	5.07^c
40	0.48	0.13	5.24	0.01	0.09	4.22
60	0.46	0.07	5.16	0.06	0.04	3.84
80	0.48	0.10	4.81	0.11	0.01	3.65
100	0.50	0.10	4.65	0.10	0.05	3.61
120	0.50	0.16	4.48	0.09	0.03	3.42

Table 7 Linear correlation between k and cp

Oligonucleotide	TEA/PA			TEA
Oligonucleotide	Intercept	Slope	R²	Intercept	Slope	R²
A10	1.6110	0.0310	0.841	2.9782	0.0266	0.816
A20	2.7694	0.0452	0.830	5.0068	0.0376	0.806
A25	3.2356	0.0480	0.830	5.7163	0.0399	0.804
A30	3.6109	0.0498	0.831	6.2791	0.0417	0.802
T5	6.9595	0.0204	0.834	7.6807	0.0165	0.894
T7	8.8489	0.0268	0.849	9.4400	0.0225	0.911
T10	10.6040	0.0314	0.866	11.1440	0.0274	0.923
T12	11.3850	0.0333	0.868	11.9050	0.0297	0.929
C5	0.2155	0.0027	0.772	0.4297	0.0017	0.496
C6	0.2714	0.0039	0.783	0.5674	0.0025	0.488
C7	0.3539	0.0054	0.808	0.7494	0.0034	0.459
C8	0.4859	0.0071	0.815	1.0169	0.0041	0.397
C9	0.6992	0.0088	0.816	1.4032	0.0046	0.316
Oligo20-1	5.0833	0.0396	0.860	6.3444	0.0330	0.867
Oligo20-2	4.8244	0.0422	0.880	5.9811	0.0353	0.893
Oligo20-3	3.9152	0.0334	0.836	5.2573	0.0266	0.836
Oligo20-4	3.4328	0.0289	0.814	4.9940	0.0239	0.788
Oligo32-1	6.6123	0.0386	0.860	7.9326	0.0319	0.876
Oligo32-2	6.7599	0.0383	0.864	7.9301	0.0322	0.879
Oligo32-3	6.7601	0.0386	0.863	7.9182	0.0324	0.870
Oligo32-4	8.4744	0.0331	0.852	9.3990	0.02617	0.915

Table 8 Correlations of k-1-cp fitted according to Eq.(9)

Oligonucleotide	TEA/PA			TEA
Oligonucleotide	A₁	B₁	R²	A₁	B₁	R²
A10	0.1012	10.026	0.984	0.1339	4.1449	0.991
A20	0.0750	5.6674	0.985	0.0907	2.2607	0.993
A25	0.0737	4.6767	0.988	0.0834	1.9013	0.994
A30	0.0726	4.0594	0.990	0.0784	1.6810	0.994
T5	0.1035	0.8199	0.987	0.1024	0.5507	0.957
T7	0.0791	0.7760	0.999	0.0815	0.4808	0.955
T10	0.0677	0.5527	0.987	0.0686	0.4111	0.948
T12	0.0636	0.4860	0.980	0.0640	0.3872	0.946
C5	1.3103	69.715	0.984	1.4721	20.595	0.942
C6	0.8572	58.660	0.981	1.0707	16.734	0.937
C7	0.6338	44.098	0.986	0.7867	13.573	0.930
C8	0.5083	30.667	0.990	0.6100	9.5254	0.915
C9	0.4201	19.968	0.993	0.4803	6.1408	0.877
C10	0.3614	11.452	0.994	0.3818	3.6390	0.762
Oligo20-1	0.0901	2.0868	0.998	0.0825	1.3597	0.995
Oligo20-2	0.0881	2.2844	0.998	0.0821	1.2991	0.993
Oligo20-3	0.1079	2.9454	0.999	0.0881	2.2844	0.998
Oligo20-4	0.1228	3.4268	0.997	0.1079	2.9454	0.999
Oligo32-1	0.0825	1.3597	0.995	0.0818	0.8813	0.989
Oligo32-2	0.0821	1.2991	0.993	0.0816	0.8847	0.989
Oligo32-3	0.0817	1.3088	0.994	0.0813	0.8989	0.991
Oligo32-4	0.0773	0.8182	0.988	0.0786	0.5428	0.960

Table 9 Quilibrium constants of K4 and K5 for oligonucleotides

Oligonucleotide	TEA/PA		TEA		Oligonucleotide	TEA/PA		TEA
Oligonucleotide	K₄	K₅	K₄	K₅	Oligonucleotide	K₄	K₅	K₄	K₅
A10	0.010	9.881β	0.0323	7.468β	C8	0.017	1.967β	0.0640	1.639β
A20	0.013	13.333β	0.0401	11.025β	C9	0.021	2.380β	0.0782	2.082β
A25	0.016	13.568β	0.0439	11.990β	C10	0.032	2.767β	0.1049	2.619β
A30	0.018	13.774β	0.0466	12.755β	Oligo20-1	0.043	11.099β	0.0607	12.121β
T5	0.126	9.662β	0.1859	9.766β	Oligo20-2	0.039	11.351β	0.0632	12.180β
T7	0.102	12.642β	0.1695	12.270β	Oligo20-3	0.037	9.268β	0.0386	11.351β
T10	0.122	14.771β	0.1669	14.577β	Oligo20-4	0.036	8.143β	0.0366	9.268β
T12	0.131	15.723β	0.1653	15.625β	Oligo32-1	0.061	12.121β	0.0928	12.225β
C5	0.019	0.763β	0.0715	0.679β	Oligo32-2	0.063	12.180β	0.0922	12.255β
C6	0.015	1.167β	0.0640	0.934β	Oligo32-3	0.062	12.240β	0.0904	12.300β
C7	0.014	1.578β	0.0580	1.271β	Oligo32-4	0.094	12.937β	0.1448	12.723β

References 33

[1]	Huber C. G., Oefner P. K., Bonn G. K., J. Chromatogr. A, 1992, 599(1/2), 113—118
[2]	Apfell A., Chakel J. A., Fischer S., Lichtenwalter K., Hancock W. S., Anal. Chem., 1997, 69(7), 1320—1325
[3]	Gilar M., Foutain K. J., Budman Y., Neue U. D., Yardley K. R., Rainville P. D., Russell R. J., Gebler J.C., J. Chromatogr. A, 2002, 958(1/2), 167—182
[4]	Huber C. G., Krajete A., Anal. Chem., 1999, 71(17), 3730—3739
[5]	Huber C. G., Krajete A., J. Chromatogr. A, 2000, 870(1/2), 413—424
[6]	Buncek M., Backovska V., Holasova A., Radilova H., Safarova M., Kunc F., Haluza R., Anal. Biochem., 2006, 348(2), 300—306
[7]	Bothner B., Chatman K., Sarkisian M., Siuzdak G., Bioorg. Med. Chem. Lett., 1995, 5(23), 2863—2868
[8]	Apffel A., Chakel J., Fischer S., Lichtenwalter K., Hancock W., J. Chromatogr. A, 1997, 777(1), 3—21
[9]	Kenski D. M., Cooper A. J., Li J. J., Willingham A. T., Haringsma H. J., Young T. A., Kuklin N. A., Jones J. J., Cancilla M. T., McMasters D. R., Nucleic Acids Res., 2010, 38(2), 660—671
[10]	Dai G., Wei X., Liu Z., Liu S., Marcucci G., Chan K. K., J. Chromatogr. B, 2005, 825(2), 201—213
[11]	Deng P., Chen X., Zhang G., Zhong D., J. Pharm. Biomed. Anal., 2010, 52(4), 571—579
[12]	Zhang G., Lin J., Srinivasan K., Kavetskaia O., Duncan J., Anal. Chem., 2007, 79(9), 3416—3424
[13]	Lin Z., Li W., Dai G., J. Pharm. Biomed. Anal., 2007, 44(2), 330—341
[14]	Oberacher H., Parson W., Muhlmann R., Huber C., Anal. Chem., 2001, 73(21), 5109—5115
[15]	Oberacher H., Oefner P., Parson W., Huber C., Angew. Chem. Int. Ed., 2001, 40(20), 3828—3830
[16]	Oberacher H., Niederstatter H., Pitterl F., Parson W., Anal. Chem., 2006, 78(22), 7816—7827
[17]	Erb R., Leithner K., Bernkop-Schnürch A., Oberacher H., AAPS J., 2012, 14(4), 728—736
[18]	McCarthy S. M., Gilar M., Gebler J., Anal. Biochem., 2009, 390(2), 181—188
[19]	Gong L. Z., McCullagh J. S. O., Rapid Commun. Mass Spectrom., 2014, 28(4), 339—350
[20]	Miyaguchi H., JoVE-J. Vis. Exp., 2016, (115), e54402
[21]	Beverly M., Hartsough K., Machemer L., Rapid Commun. Mass Spectrom.,2005, 19(12), 1675—1682
[22]	Beverly M., Hartsough K., Machemer L., Pavco P., Lockridge J., J. Chromatogr. B, 2006, 835(1/2), 62—70
[23]	Levin D. S., Shepperd B. T., Gruenloh C. J., J. Chromatogr. B, 2011, 879(19), 1587—1595
[24]	Yuan N., Han S. Y., Yang J., Qiao J. Q., Liu Y., Lian H. Z., Curr. Anal. Chem.,2012, 8(4), 550—556
[25]	Qiao J. Q., Liang C., Wei L. C., Cao Z. M., Lian H. Z., J. Sep. Sci., 2016, 39(23), 4502—4511
[26]	Tomlinson E., Riley C. M., Jefferies T. M., J. Chromatogr. A, 1979, 173(1), 89—100
[27]	Wang Y. P., Shen G. Q., Zhu M. H., Acta Chim. Sinica, 1993, 51, 392—396
	(王延平, 沈国钦, 朱明华. 化学学报, 1993, 51, 392—396)
[28]	Han S. Y., Qiao J. Q., Zhang Y. Y., Yang L. L., Lian H. Z., Ge X., Chen H. Y., Chemosphere, 2011, 83(2), 131—136
[29]	Huber C. G., Oefner P. J., Bonn G. K., Anal. Biochem., 1993, 212(2), 351—358
[30]	Lee D. P., Kindsvater J. H., Anal. Chem., 1980, 52(14), 2425—2428
[31]	Huber C. G., Oefner P. J., Bonn G. K., J. Chromatogr. A, 1992, 599(1/2), 113—118
[32]	Knox J. H., Hartwick R. A., J Chromatogr., 1981, 204(1), 3—21
[33]	Horvath C., Melander W., Monlar I., Anal. Chem., 1977, 49(1), 142—154