Effects of Electrospun Fiber-Stiffness on Adhesion and Migration of iPS-MSCs†

doi:10.7503/cjcu20170542

Abstract

Abstract:

The stiffness of as-electrospun poly-L-lactic acid(PLLA) fibers was altered by annealing treatment, and then influence of fiber stiffness on the morphology, proliferation and migration of induced pluripotent stem cell-derived mesenchymal stem cells(iPS-MSCs) were evaluated. The results showed that annealing treatment had negligible influence on the diameter of PLLA fibers[before: (1.26±0.25) μm and after: (1.24±0.26) μm]. However, fiber crystallinity and mechanical properties were enhanced, which resulted in 1.73 times stiffer than that of fibers before annealing treatment. The cell spreading area and proliferation of iPS-MSCs cultured on the treated PLLA scaffold after 1 and 7 d of incubation were 1.78 and 1.18 times higher, respectively, than that of untreated scaffold. The increase of fiber stiffness can affect the migration of iPS-MSCs and promote up-regulated expression of the migration-related genes Integrinβ1, RhoA and Rock1. Collectively, this study demonstrated that increasing fiber stiffness by annealing may be used as an important modality to regulate cell biological functions of the cells in engineering tissues.

Key words: Electrospun fiber, Fiber stiffness, Induced pluripotent stem cell-derived mesenchymal stem cells(iPS-MSCs), Cell adhesion, Cell migration

CLC Number:

O631
R318.08

TrendMD:

YU Zhepao, YUAN Huihua, YI Bingcheng, WANG Xianliu, ZHANG Zhaowenbin, ZHANG Yanzhong. Effects of Electrospun Fiber-Stiffness on Adhesion and Migration of iPS-MSCs^†[J]. Chem. J. Chinese Universities, 2018, 39(4): 807.

Figures/Tables 12

Scheme 1 Schematic of cell migration experiment

Table 1 Primer sequences of speciﬁc genes used for qRT-PCR

Gene	Forward primer sequence(5'-3')	Reverse primer sequence(5'-3')
Integrinβ1	ATGCCAAATCTTGCGGAGAAT	TTTGCTGCGATTGGTGACATT
RhoA	AGCTTGTGGTAAGACATGCTTG	GTGTCCCATAAAGCCAACTCTAC
Rock1	GACTGGGGACAGTTTTGAGAC	ATCCAAATCATAAACCAGGGCAT
GAPDH	TGACCTCAACTACATGGTCTACA	CTTCCCATTCTCGGCCTTG

Fig.1 SEM images(A, B) and the diameter distribution(C, D) of electrospun PLLA fibers before(A, C) and after(B, D) annealing treatmentInsets of (A) and (B): high magnification SEM images of electrospun PLLA fibers before and after annealing treatment.

Fig.2 DSC(A) and XRD(B) analysis of electrospun PLLA fibers before(a) and after(b) annealing treatment

Table 2 Thermal data of PLLA fibers before and after annealing treatment

Sample	T_g/℃	T_c/℃	T_m/℃	ΔH_c/(J·g^-1)	ΔH_m/(J·g^-1)	X_c(%)
PLLA	56.19	80.23	179.38	1.84	11.96	10.88
Annealing	58.51		177.43		10.50	11.29

Fig.3 Tensile properties and stiffness of the electrospun PLLA fibrous membranes before and after annealing treatment(A) Typical stress-strain curves; (B) tensile strength and fiber stiffness; (C) Young’s modulus; (D) strain at break.* P<0.05; ** P<0.01.

Fig.4 Fluorescent images of iPS-MSCs cultured on as-electrospun(A) and annealed electrospun PLLA fiber scaffolds for 24 h(B) and quantitative results of the spreading area of iPS-MSCs(C)The F-actin(red) and nuclei(blue) of cells were stained by Rhodamine-phalloidin and DAPI, respectively. **P<0.01.

Fig.5 SEM micrographs of iPS-MSCs cultured on as-electrospun(A, C) and annealed electrospun PLLA fiber scaffolds(B, D) for 4 d(A, B) and 7 d(C, D)

Fig.6 Proliferation of iPS-MSCs on as-electrospun and annealed electrospun PLLA fiber scaffolds* P< 0.05, **P< 0.01.

Fig.8 iPS-MSCs migration on as-electrospun(A-C) and annealed electrospun PLLA fiber scaffolds(D-F) for 0 h(A, D), 48 h(B, E) and 72 h(C, F)

Fig.8 Quantitative measurment of iPS-MSCs migration after culturing the cells on as-electrospun and annealed electrospun PLLA fibrous scaffolds for 0, 48 and 72 h

Fig.9 Migration-related genes expression of iPS-MSCs cultured on as-electrospun and annealed electrospun PLLA fiber scaffolds for 1, 3 and 4 d(A) Integrinβ1; (B) RhoA; (C) Rock1.

References 41

[1]	Aman A., Piotrowski T., Developmental Biology, 2010, 341, 20-33
[2]	Keller R., Current Opinion in Cell Biology, 2005, 17, 533-541
[3]	Hatten M. E., Annual Review of Neuroscience, 1999, 22, 511-539
[4]	Friedl P., Weigelin B., Nature Immunology, 2008, 9(9), 960-969
[5]	Rossant J., Howard L., Annual Review of Cell and Developmental Biology, 2002, 18, 541-573
[6]	Braiman-Wiksman L., Solomonik I., Spira R., Tennenbaum T., Toxicologic Pathology, 2007, 35, 767-779
[7]	Ridley A. J., Schwartz M. A., Burridge K., Firtel R. A., Ginsberg M. H., Borisy G., Parsons J. T., Horwitz A. R., Science,2003, 302(5651), 1704-1709
[8]	Lauffenburger D. A., Horwitz A. F., Cell,1996, 84, 359-369
[9]	Nemir S., West J. L., Annals of Biomedical Engineering, 2010, 38(1), 2-20
[10]	Flanagan L. A., Ju Y. E., Marg B., Osterfield M., Janmey P. A., Neuroreport,2002, 13(18), 2411-2415
[11]	Paszek M. J., Zahir N., Johnson K. R., Lakins J. N., Rozenberg G. I., Gefen A., Reinhart-King C. A., Margulies S. S., Dembo M., Boettiger D., Hammer D. A., Weaver V. M., Cancer Cell, 2005, 8, 241-254
[12]	Engler A. J., Griffin M. A., Sen S., Bonnetnann C. G., Sweeney H. L., Discher D. E., Journal of Cell Biology, 2004, 166, 877-887
[13]	Subramanian A., Lin H. Y., Journal of Biomedical Materials Research Part A,2005, 75A, 742-753
[14]	Evans N. D., Minelli C., Gentleman E., LaPointe V., Patankar S. N., Kallivretaki M., Chen X. Y., Roberts C. J., Stevens M. M., European Cells & Materials, 2009, 18, 1-14
[15]	Mauck R. L., Baker B. M., Nerurkar N. L., Burdick J. A., Li W. J., Tuan R. S., Elliott D M., Tissue Engineering Part B, Reviews,2009, 15, 171-193
[16]	Li W. J., Laurencin C. T., Caterson E. J., Tuan R. S., Ko F. K., Journal of Biomedical Materials Research,2002, 60, 613-621
[17]	Sill T. J., von Recum H. A., Biomaterials, 2008, 29, 1989-2006
[18]	Yin Z., Chen X., Chen J. L., Shen W. L., Nguyen T. M. H., Gao L., Ouyang H. W., Biomaterials, 2010, 31, 2163-2175
[19]	Zhang Y. Z., Ouyang H. W., Lim C. T., Ramakrishna S., Huang Z. M., Journal of Biomedical Materials Research Part B, Applied Biomaterials,2005, 72B, 156-165
[20]	Yoo H. S., Kim T. G., Park T. G., Advanced Drug Delivery Reviews, 2009, 61, 1033-1042
[21]	Zhang Y. Z., Venugopal J., Huang Z. M., Lim C. T., Ramakrishna S., Biomacromolecules,2005, 6, 2583-2589
[22]	Skotak M., Noriega S., Larsen G., Subramanian A., Journal of Biomedical Materials Research Part A,2010, 95A, 828-836
[23]	Jiang X., Nai M. H., Lim C. T., Visage C. L., Chan J. K. Y., Chew S. Y., Journal of Biomedical Materials Research Part A,2015, 103, 959-968
[24]	Vatankhah E., Prabhakaran M. P., Semnani D., Razavi S., Zamani M., Ramakrishna S., ACS Applied Materials & Interfaces,2014, 6, 4089-4101
[25]	Takasaki M., Ito H., Kikutani T., Journal of Macromolecular Science-Physics, 2003, B42, 403-420
[26]	Furuhashi Y., Kimura Y., Yoshie N Yamane H., Polymer,2006, 47, 5965-5972
[27]	Arias V., Odelius K., Hoglund A., Albertsson A. C., ACS Sustainable Chemistry & Engineering,2015, 3, 2220-2231
[28]	Yuan H. H., Zhou Y. X., Lee M. S., Zhang Y. Z., Li W. J., Acta Biomaterialia, 2016, 42, 247-257
[29]	Xie J., Peng C., Zhao Q. H., Wang X. L., Yuan H. H., Yang L. L., Li K., Lou X. X., Zhang Y. Z., Acta Biomaterialia, 2016, 29, 365-379
[30]	Dersch R., Liu T. Q., Schaper A. K., Greiner A., Wendorff J. H., Journal of Polymer Science Part A, Polymer Chemistry,2003, 41, 545-553
[31]	Simonet M., Stingelin N., Wismans J. G. F., Oomens C. W. J., Driessen-Mol A., Baaijens F. P. T., Journal of Materials Chemistry B,2014, 2, 305-313
[32]	Kark L. R., Karp J. M., Davies J. E., Clinical Oral Implants Research, 2006, 17, 321-327
[33]	Kolambkar Y. M., Bajin M., Wojtowicz A., Hutmacher D. W., Garcia A. J., Guldberg R. E., Tissue Engineering Part A, 2014, 20, 398-409
[34]	Puiggali J., Ikada Y., Tsuji H., Cartier L., Okihara T., Lotz B., Polymer,2000, 41, 8921-8930
[35]	Deitzel J. M., Kleinmeyer J. D., Hirvonen J. K., Beck Tan N. C., Polymer,2001, 42, 8163-8170
[36]	Zong X. H., Kim K., Fang D. F., Ran S. F., Hsiao B. S., Chu B., Polymer,2002, 43, 4403-4412
[37]	Pan P. J., Zhu B., Kai W. H., Dong T., Inoue Y., Macromolecules,2008, 41, 4296-4304
[38]	Halliday N. L., Tomasek J. J., Experimental Cell Research, 1995, 217, 109-117
[39]	Pelham R. J., Wang Y. L., Proceedings of the National Academy of Sciences of the United States of America,1997, 94, 13661-13665
[40]	Katsumi A., Orr A. W., Tzima E., Schwartz M. A., Journal of Biological Chemistry, 2004, 279(13), 12001-12004
[41]	Wang F., Weaver V. M., Petersen O. W., Larabell C. A., Dedhar S., Briand P., Lupu R., Bissell M. J., Proceedings of the National Academy of Sciences of the United States of America,1998, 95, 14821-14826