Chem. J. Chinese Universities ›› 2018, Vol. 39 ›› Issue (4): 807.doi: 10.7503/cjcu20170542
• Polymer Chemistry • Previous Articles Next Articles
YU Zhepao, YUAN Huihua, YI Bingcheng, WANG Xianliu, ZHANG Zhaowenbin, ZHANG Yanzhong*(
)
Received:2017-08-08
Online:2018-04-10
Published:2018-03-27
Contact:
ZHANG Yanzhong
E-mail:yzzhang@dhu.edu.cn
Supported by:CLC Number:
TrendMD:
YU Zhepao, YUAN Huihua, YI Bingcheng, WANG Xianliu, ZHANG Zhaowenbin, ZHANG Yanzhong. Effects of Electrospun Fiber-Stiffness on Adhesion and Migration of iPS-MSCs†[J]. Chem. J. Chinese Universities, 2018, 39(4): 807.
| Gene | Forward primer sequence(5'-3') | Reverse primer sequence(5'-3') |
|---|---|---|
| Integrinβ1 | ATGCCAAATCTTGCGGAGAAT | TTTGCTGCGATTGGTGACATT |
| RhoA | AGCTTGTGGTAAGACATGCTTG | GTGTCCCATAAAGCCAACTCTAC |
| Rock1 | GACTGGGGACAGTTTTGAGAC | ATCCAAATCATAAACCAGGGCAT |
| GAPDH | TGACCTCAACTACATGGTCTACA | CTTCCCATTCTCGGCCTTG |
Table 1 Primer sequences of specific genes used for qRT-PCR
| Gene | Forward primer sequence(5'-3') | Reverse primer sequence(5'-3') |
|---|---|---|
| Integrinβ1 | ATGCCAAATCTTGCGGAGAAT | TTTGCTGCGATTGGTGACATT |
| RhoA | AGCTTGTGGTAAGACATGCTTG | GTGTCCCATAAAGCCAACTCTAC |
| Rock1 | GACTGGGGACAGTTTTGAGAC | ATCCAAATCATAAACCAGGGCAT |
| GAPDH | TGACCTCAACTACATGGTCTACA | CTTCCCATTCTCGGCCTTG |
Fig.1 SEM images(A, B) and the diameter distribution(C, D) of electrospun PLLA fibers before(A, C) and after(B, D) annealing treatmentInsets of (A) and (B): high magnification SEM images of electrospun PLLA fibers before and after annealing treatment.
| Sample | Tg/℃ | Tc/℃ | Tm/℃ | ΔHc/(J·g-1) | ΔHm/(J·g-1) | Xc(%) |
|---|---|---|---|---|---|---|
| PLLA | 56.19 | 80.23 | 179.38 | 1.84 | 11.96 | 10.88 |
| Annealing | 58.51 | 177.43 | 10.50 | 11.29 |
Table 2 Thermal data of PLLA fibers before and after annealing treatment
| Sample | Tg/℃ | Tc/℃ | Tm/℃ | ΔHc/(J·g-1) | ΔHm/(J·g-1) | Xc(%) |
|---|---|---|---|---|---|---|
| PLLA | 56.19 | 80.23 | 179.38 | 1.84 | 11.96 | 10.88 |
| Annealing | 58.51 | 177.43 | 10.50 | 11.29 |
Fig.3 Tensile properties and stiffness of the electrospun PLLA fibrous membranes before and after annealing treatment(A) Typical stress-strain curves; (B) tensile strength and fiber stiffness; (C) Young’s modulus; (D) strain at break.* P<0.05; ** P<0.01.
Fig.4 Fluorescent images of iPS-MSCs cultured on as-electrospun(A) and annealed electrospun PLLA fiber scaffolds for 24 h(B) and quantitative results of the spreading area of iPS-MSCs(C)The F-actin(red) and nuclei(blue) of cells were stained by Rhodamine-phalloidin and DAPI, respectively. **P<0.01.
Fig.8 Quantitative measurment of iPS-MSCs migration after culturing the cells on as-electrospun and annealed electrospun PLLA fibrous scaffolds for 0, 48 and 72 h
Fig.9 Migration-related genes expression of iPS-MSCs cultured on as-electrospun and annealed electrospun PLLA fiber scaffolds for 1, 3 and 4 d(A) Integrinβ1; (B) RhoA; (C) Rock1.
| [1] | Aman A., Piotrowski T., Developmental Biology, 2010, 341, 20-33 |
| [2] | Keller R., Current Opinion in Cell Biology, 2005, 17, 533-541 |
| [3] | Hatten M. E., Annual Review of Neuroscience, 1999, 22, 511-539 |
| [4] | Friedl P., Weigelin B., Nature Immunology, 2008, 9(9), 960-969 |
| [5] | Rossant J., Howard L., Annual Review of Cell and Developmental Biology, 2002, 18, 541-573 |
| [6] | Braiman-Wiksman L., Solomonik I., Spira R., Tennenbaum T., Toxicologic Pathology, 2007, 35, 767-779 |
| [7] | Ridley A. J., Schwartz M. A., Burridge K., Firtel R. A., Ginsberg M. H., Borisy G., Parsons J. T., Horwitz A. R., Science,2003, 302(5651), 1704-1709 |
| [8] | Lauffenburger D. A., Horwitz A. F., Cell,1996, 84, 359-369 |
| [9] | Nemir S., West J. L., Annals of Biomedical Engineering, 2010, 38(1), 2-20 |
| [10] | Flanagan L. A., Ju Y. E., Marg B., Osterfield M., Janmey P. A., Neuroreport,2002, 13(18), 2411-2415 |
| [11] | Paszek M. J., Zahir N., Johnson K. R., Lakins J. N., Rozenberg G. I., Gefen A., Reinhart-King C. A., Margulies S. S., Dembo M., Boettiger D., Hammer D. A., Weaver V. M., Cancer Cell, 2005, 8, 241-254 |
| [12] | Engler A. J., Griffin M. A., Sen S., Bonnetnann C. G., Sweeney H. L., Discher D. E., Journal of Cell Biology, 2004, 166, 877-887 |
| [13] | Subramanian A., Lin H. Y., Journal of Biomedical Materials Research Part A,2005, 75A, 742-753 |
| [14] | Evans N. D., Minelli C., Gentleman E., LaPointe V., Patankar S. N., Kallivretaki M., Chen X. Y., Roberts C. J., Stevens M. M., European Cells & Materials, 2009, 18, 1-14 |
| [15] | Mauck R. L., Baker B. M., Nerurkar N. L., Burdick J. A., Li W. J., Tuan R. S., Elliott D M., Tissue Engineering Part B, Reviews,2009, 15, 171-193 |
| [16] | Li W. J., Laurencin C. T., Caterson E. J., Tuan R. S., Ko F. K., Journal of Biomedical Materials Research,2002, 60, 613-621 |
| [17] | Sill T. J., von Recum H. A., Biomaterials, 2008, 29, 1989-2006 |
| [18] | Yin Z., Chen X., Chen J. L., Shen W. L., Nguyen T. M. H., Gao L., Ouyang H. W., Biomaterials, 2010, 31, 2163-2175 |
| [19] | Zhang Y. Z., Ouyang H. W., Lim C. T., Ramakrishna S., Huang Z. M., Journal of Biomedical Materials Research Part B, Applied Biomaterials,2005, 72B, 156-165 |
| [20] | Yoo H. S., Kim T. G., Park T. G., Advanced Drug Delivery Reviews, 2009, 61, 1033-1042 |
| [21] | Zhang Y. Z., Venugopal J., Huang Z. M., Lim C. T., Ramakrishna S., Biomacromolecules,2005, 6, 2583-2589 |
| [22] | Skotak M., Noriega S., Larsen G., Subramanian A., Journal of Biomedical Materials Research Part A,2010, 95A, 828-836 |
| [23] | Jiang X., Nai M. H., Lim C. T., Visage C. L., Chan J. K. Y., Chew S. Y., Journal of Biomedical Materials Research Part A,2015, 103, 959-968 |
| [24] | Vatankhah E., Prabhakaran M. P., Semnani D., Razavi S., Zamani M., Ramakrishna S., ACS Applied Materials & Interfaces,2014, 6, 4089-4101 |
| [25] | Takasaki M., Ito H., Kikutani T., Journal of Macromolecular Science-Physics, 2003, B42, 403-420 |
| [26] | Furuhashi Y., Kimura Y., Yoshie N Yamane H., Polymer,2006, 47, 5965-5972 |
| [27] | Arias V., Odelius K., Hoglund A., Albertsson A. C., ACS Sustainable Chemistry & Engineering,2015, 3, 2220-2231 |
| [28] | Yuan H. H., Zhou Y. X., Lee M. S., Zhang Y. Z., Li W. J., Acta Biomaterialia, 2016, 42, 247-257 |
| [29] | Xie J., Peng C., Zhao Q. H., Wang X. L., Yuan H. H., Yang L. L., Li K., Lou X. X., Zhang Y. Z., Acta Biomaterialia, 2016, 29, 365-379 |
| [30] | Dersch R., Liu T. Q., Schaper A. K., Greiner A., Wendorff J. H., Journal of Polymer Science Part A, Polymer Chemistry,2003, 41, 545-553 |
| [31] | Simonet M., Stingelin N., Wismans J. G. F., Oomens C. W. J., Driessen-Mol A., Baaijens F. P. T., Journal of Materials Chemistry B,2014, 2, 305-313 |
| [32] | Kark L. R., Karp J. M., Davies J. E., Clinical Oral Implants Research, 2006, 17, 321-327 |
| [33] | Kolambkar Y. M., Bajin M., Wojtowicz A., Hutmacher D. W., Garcia A. J., Guldberg R. E., Tissue Engineering Part A, 2014, 20, 398-409 |
| [34] | Puiggali J., Ikada Y., Tsuji H., Cartier L., Okihara T., Lotz B., Polymer,2000, 41, 8921-8930 |
| [35] | Deitzel J. M., Kleinmeyer J. D., Hirvonen J. K., Beck Tan N. C., Polymer,2001, 42, 8163-8170 |
| [36] | Zong X. H., Kim K., Fang D. F., Ran S. F., Hsiao B. S., Chu B., Polymer,2002, 43, 4403-4412 |
| [37] | Pan P. J., Zhu B., Kai W. H., Dong T., Inoue Y., Macromolecules,2008, 41, 4296-4304 |
| [38] | Halliday N. L., Tomasek J. J., Experimental Cell Research, 1995, 217, 109-117 |
| [39] | Pelham R. J., Wang Y. L., Proceedings of the National Academy of Sciences of the United States of America,1997, 94, 13661-13665 |
| [40] | Katsumi A., Orr A. W., Tzima E., Schwartz M. A., Journal of Biological Chemistry, 2004, 279(13), 12001-12004 |
| [41] | Wang F., Weaver V. M., Petersen O. W., Larabell C. A., Dedhar S., Briand P., Lupu R., Bissell M. J., Proceedings of the National Academy of Sciences of the United States of America,1998, 95, 14821-14826 |
| [1] | WANG Xuebin, XUE Yuan, MAO Hua’nyu, XIANG Yanxin, BAO Chunyan. Preparation of Photo/reduction Dual-responsive Hydrogel Microspheres and Their Application in Three-dimensional Cell Culture [J]. Chem. J. Chinese Universities, 2022, 43(8): 20220116. |
| [2] | WEN Jing, XU Zhimin, QI Desheng, WANG Jiayu, YU Shuangjiang, HE Chaoliang, HAN Bing. PLG-g-TA/RGD Enzyme-catalyzed Crosslinked Hydrogel for Adhesion and Three-dimensional Culture of Hyaline Chondrocytes † [J]. Chem. J. Chinese Universities, 2019, 40(9): 2020. |
| [3] | WANG Yiyu, LIU Jiawei, SIMA Zhenhua, SONG Houpan, LI Ruliu, CAI Jiazhong, CHEN Weiwen. Isolation, Structural Characterization and IEC-6 Cell Migration Activities of Polysaccharides From Atractylodes Macrocephala Koidz† [J]. Chem. J. Chinese Universities, 2015, 36(2): 299. |
| [4] | WANG Jun1, WANG Wei1, LIU Yuan1, ZHU Xiao-Cui1, YUAN Zhi1*, TANG Shi-Ming2, LIU Min2, TANG Hua2. HUVEC Adhesion on Polylactides with Pendant Carboxyl Arms and Its Cell Activity [J]. Chem. J. Chinese Universities, 2008, 29(11): 2317. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||