High-throughput Biological Microarrays Based on Framework Nucleic Acids

doi:10.7503/cjcu20220563

Abstract

Abstract:

A high-throughput biological microarray based on framework nucleic acid（FNA） was constructed. Using an automated ultra-micro pipetting platform， the droplets containing FNAs-based probes were fabricated onto the glass substrates according to the pre-defined commands. After the targets were captured by the probes， the micro- arrays were scanned by the integrated gene chip scanner， the results of which could be further used for the quantifi- cation of target concentration. It was found that the FNA probes could be prepared with high throughput on the bio- logical microarrays， and the microarrays with 150000 spots can be prepared within 24 h. Moreover， the relative deviation（W） of distance between the points is less than 10%， and the coefficient of variation（CV） of fluorescence intensity is 3.30%. The properties of each spot on the microarrays were stable， which is much higher than the national standard. Additionally， we demonstrated that the FNA-based microarray possessed high addressability， high sen- sitivity and high-throughput capabilities. The limit of detection for nucleic acid target was down to 100 pmol/L. With the progress of various probe technologies， the microarray platform shows great potential for bioanalysis.

Key words: High-throughput detection, Framework nucleic acid, Nucleic acid target, Biological microarray

CLC Number:

O657

TrendMD:

SONG Lu, ZHANG Shuyang, WANG Lihua, ZUO Xiaolei, LI Min. High-throughput Biological Microarrays Based on Framework Nucleic Acids[J]. Chem. J. Chinese Universities, 2023, 44(2): 20220563.

Figures/Tables 6

References 36

1	Zhao S. L.， Chen H.， Quant. Biol.， 2020， 8（1）， 11—19
2	Bhargava A.， Infect.， Genet. Evol.， 2021， 87， 104657
3	Emam M.， Oweda M.， Antunes A.， El⁃Hadidi M.， Virus Res.， 2021， 302， 198472
4	Qin S. M.， Liu S. Y.， Zhu Y.， Lv M.， Nucl. Sci. Tech.， 2022， 45（3）， 030502
5	Gut I. G.， Hum. Mutat.， 2001， 17（6）， 475—492
6	Collins F. S.， Morgan M.， Patrinos A.， Science， 2003， 300（5617）， 286—290
7	Carter L. J.， Garner L. V.， Smoot J. W.， Li Y.， Zhou Q.， Saveson C. J.， Sasso J. M.， Gregg A. C.， Soares D. J.， Beskid T. R.， Jervey S. R.， Liu C.， ACS Cent. Sci.， 2020， 6（5）， 591—605
8	Iglói Z.， Leven M.， Abdel⁃Karem Abou⁃Nouar Z.， Weller B.， Matheeussen V.， Coppens J.， Koopmans M.， Molenkamp R.， J. Clin. Virol.， 2020， 129， 104510
9	Waller J. V.， Kaur P.， Tucker A.， Lin K. K.， Diaz M. J.， Henry T. S.， Hope M.， AJR， Am. J. Roentgenol.， 2020， 215（4）， 834—838
10	Sule W. F.， Oluwayelu D. O.， Pan Afr. Med. J.， 2020， 35， 121
11	Teymouri M.， Mollazadeh S.， Mortazavi H.， Naderi Ghale⁃Noie Z.， Keyvani V.， Aghababaei F.， Hamblin M. R.， Abbaszadeh⁃Goudarzi G.， Pourghadamyari H.， Hashemian S. M. R.， Mirzaei H.， Pathol. Res. Pract.， 2021， 221， 153443
12	Mak G. C. K， Cheng P. K. C.， Lau S. S. Y.， Wong K. K. Y.， Lau C. S， Lam E. T. K.， Chan R. C. W.， Tsang D. N. C.， J. Clin. Virol.， 2020 ， 129， 104500
13	Wen J. L.， Chen J. H.， Zhang L.， Zhou S. G.， Biosens. Bioeletron.， 2017， 90（15）， 481—486
14	Peng Y.， Pan Y. H.， Sun Z. W.， Li J. L.， Yi Y. X.， Yang J.， Li G. X.， Biosens. Bioeletron.， 2021， 186（15）， 113309
15	Yoshikawa A. M.， Wan L.， Zheng L.， Eisenstein M.， Soh H. T.， Proc. Natl. Acad. Sci. USA， 2022， 119（12）， e2119945119
16	Dong Z. Z.， Xue X. Y.， Liang H. L.， Guan J. J.， Chang L. Q.， Anal. Chem.， 2021， 93（4）， 1855—1865
17	Pregibon D. C.， Toner M.， Doyle P. S.， Science， 2007， 315（5817）， 1393—1396
18	Liu G.， Lao R. J.， Xu L.， Xu Q.， Li L. Y.， Zhang M.， Song S. P.， Fan C. H.， Biosens. Bioelectron.， 2013， 42， 516—521
19	Li Z. H.， Zhao B.， Wang D. F.， Wen Y. L.， Liu G.， Dong H. Q.， Song S. P.， Fan C. H.， ACS Appl. Mater. Interfaces， 2014， 6（20）， 17944—17953
20	Quispe⁃Tintaya W.， Gorbacheva T.， Lee M.， Makhortov S.， Popov V. N.， Vijg J.， Maslov A. Y.， Nat. Methods， 2016， 13（7）， 584—586
21	Datlinger P.， Rendeiro AF.， Boenke T.， Senekowitsch M.， Krausgruber T.， Barreca D.， Bock C.， Nat. Methods， 2021， 18（6）， 635—642
22	Chen S.， Lake B. B.， Zhang K.， Nat. Biotechnol.， 2019， 37（12）， 1452—1457
23	Zheng W. S.， Zhao S. J.， Yin Y. H.， Zhang H. D.， Needham D. M.， Evans E. D.， Dai C. L.， Lu P. J.， Alm E. J.， Weitz D. A.， Science， 2022， 376（6597）， eabm1483
24	Massey D. J.， Koren A.， Nat. Commun.， 2022， 13（1）， 2402
25	Aynaud M. M.， Hernandez J. J.， Barutcu S.， Braunschweig U.， Chan K.， Pearson J. D.， Trcka D.， Prosser S. L.， Kim J.， Rodiles M. B.， Jen M.， Song S. Y.， Shen J.， Bruce C.， Hazlett B.， Poutanen S.， Attisano L.， Bremner R.， Blencowe B. J.， Mazzulli T.， Han H.， Pelletier L.， Wrana J. L.， Nat. Commun.， 2021， 12（1）， 1405
26	Zhao H. P.， Ma J. L.， Zuo X. L.， Li F.， Chin. J. Chem.， 2021， 39，1745—1752
27	Costa J. A.， Dentinger P. M.， McGall G. H.， Crnogorac F.， Zhou W.， ACS Appl. Mater. Interfaces， 2019， 11（34）， 30534—30541
28	Huang Q. L.， Chen J.， Li J.， Zhu Y.， Wang L. H.， Nucl. Sci. Tech.， 2021， 44（7）， 53—58
29	Li F. Q.， Mao X. H.， Li F.， Li M.， Shen J. L.， Ge Z. L.， Fan C. H.， Zuo X. L.， J. Am. Chem. Soc.， 2020， 142（22）， 9975—9981
30	Li M.， Yin F. F.， Song L.， Mao X. H.， Li F.， Fan C. H.， Zuo X. L.， Xia Q.， Chem. Rev.， 2021， 121（17）， 10469—10558
31	Song L.， Zhuge Y.， Zuo X. L.， Li M.， Wang F.， Adv. Sci.， 2022， 9， 2200327
32	Lin M. H.， Song P.， Zhou G. B.， Zuo X. L.， Aldalbahi A.， Lou X. D.， Shi J. Y.， Fan C. H.， Nat. Protoc.， 2016， 11， 1244—1263
33	Li F.， Li J.， Dong B. J.， Wang F.， Fan C. H.， Zuo X. L.， Chem. Soc. Rev.， 2021， 50， 5650—5667
34	Lin M. H.， Wang J. J.， Zhou G. B.， Wang J. B.， Wu N.， Lu J. X.， Gao J. M.， Chen X. Q.， Shi J. Y.， Zuo X. L.， Fan C. H.， Angew. Chem. Int. Ed.， 2015， 54（7）， 2151—2155
35	Wen J. L.， Chen J. H.， Zhuang L.， Zhou S. G.， Biosens. Bioeletron.， 2017， 90， 481—486
36	Oudeng G.， Benz M.， Popova A. A.， Zhang Y.， Yi C. Q.， Levkin P. A.， Yang M.， ACS Appl. Mater. Interfaces， 2020， 12， 55614—55623

Name	Sequence（5'—3'）
A17⁃Cy3	ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTATTAGGTCGCATCAACATCAGTCTGATAAGCTATGCGACCT⁃Cy3
A17⁃ssDNA	CATCTTGCCTAAAAAAAAAAACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTA
B17	NH₂⁃TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATAC
C17	NH₂⁃TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTTC
D17	NH₂⁃TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCAT
ss⁃Control	NH₂⁃AAAAAAAAAATCCGTTCTAC
Com⁃A17	TTTTTTTTTTAGGCAAGATG⁃Cy3

Name	Sequence（5'—3'）
A17⁃Cy3	ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTATTAGGTCGCATCAACATCAGTCTGATAAGCTATGCGACCT⁃Cy3
A17⁃ssDNA	CATCTTGCCTAAAAAAAAAAACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTA
B17	NH₂⁃TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATAC
C17	NH₂⁃TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTTC
D17	NH₂⁃TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCAT
ss⁃Control	NH₂⁃AAAAAAAAAATCCGTTCTAC
Com⁃A17	TTTTTTTTTTAGGCAAGATG⁃Cy3